We narrowed to 14,341 results for: cas9 genes
-
Plasmid#124449PurposeExpresses dead Cas9 (dCas9)-CBE4-gamDepositorInsertdCBE4-gam
UseCRISPR and Synthetic BiologyExpressionMammalianMutationD10A, H840AAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE666
Plasmid#153231PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGE668
Plasmid#153233PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE667
Plasmid#153232PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE652
Plasmid#153230PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-nCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79619PurposeExpresses nCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
Tags3xFlag-PmCDA1ExpressionMammalianMutationD10A for nickase Cas9PromoterpCMVAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79621PurposeExpresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionMammalianMutationD10A and H840A for nuclease deficient Cas9PromoterpCMVAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgMTOR_49
Plasmid#125132PurposeTargeting 49th exon of human MLST8 gene by CRISPR-Cas9DepositorAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT131_GalL_cCDA1-NGBE3
Plasmid#145095PurposeExpressing base editor cCDA1-NGBE3 in yeast cellsDepositorInsertcCDA1-NGBE3
UseCRISPRExpressionYeastMutationspCas9(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1…PromoterGalLAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only