We narrowed to 13,850 results for: sequence

#105680

Bacterial Expression construct of N terminus of SIRT1: Exon1-Exon2-Exon3

Ullas Kolthur-Seetharam

Deota et al Cell Rep. 2017 Mar 28;18(13):3069-3077.

April 6, 2018

Academic Institutions and Nonprofits only

#92033

pSIREN-RetroQ vector containing shRNA sequence to HPSE

Joe Landry

Mayes et al Oncotarget. 2017 May 12;8(38):64344-6435

July 19, 2017

Industry, Academic Institutions, and Nonprofits

#92034

pSIREN-RetroQ vector containing shRNA sequence to HPSE

Joe Landry

Mayes et al Oncotarget. 2017 May 12;8(38):64344-6435

July 19, 2017

Industry, Academic Institutions, and Nonprofits

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#86007

lenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#86009

lenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#74430

Calb2 UTR with mutated AU binding sequence and mir-30 site 1 and 2

Emanuela Felley-Bosco, Rolf Stahel

Kresoja-Rakic et al Front Genet. 2017 May 29;8:70. doi: 10.3

April 21, 2016

Academic Institutions and Nonprofits only

#72003

Expresses the N-terminal extracellular region of the PlexinB2 protein following proteolytic cleavage (ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 25, 2016

Academic Institutions and Nonprofits only

#72082

Expresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 12, 2016

Academic Institutions and Nonprofits only

#72080

Expresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 12, 2016

Academic Institutions and Nonprofits only

#71958

Expresses the extracellular region of the LRRC4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 2, 2016

Academic Institutions and Nonprofits only

#71954

Expresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 2, 2016

Academic Institutions and Nonprofits only

#71955

Expresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 1, 2016

Academic Institutions and Nonprofits only

#71956

Expresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 26, 2016

Academic Institutions and Nonprofits only

#232837

AAV transfer plasmid for Syn-mediated expression of soma-targeted FRCaMPi

Kiryl Piatkevich

Zhou et al PLoS Biol. 2025 Apr 29;23(4):e3003048. d

June 26, 2025

Academic Institutions and Nonprofits only