We narrowed to 27,974 results for: crispr grnas
-
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold R4-R3
Plasmid#62131PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-L4
Plasmid#62128PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-R5
Plasmid#62127PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Blunt-U6-HES7-STOP-gRNA
Plasmid#130933PurposegRNA for tag human HES7DepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L4
Plasmid#62129PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L2
Plasmid#62130PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [2_n-1] (GB1206)
Plasmid#75407PurposetRNA and scaffold for the assembly of GBoligomers for the intermediate position (positon [2_n-1]) of a polycistronic tRNA-gRNA (3-part multiplexing)DepositorInserttRNA-gRNA position [2_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sglacZ: pHR-hU6-CasMINI sgRNA_#2 (sgLacZ); EF1a-Puro-T2A-BFP- WPRE
Plasmid#176272PurposeExpression of non-targeting sgRNA of CasMINIDepositorInsertCasMINI non-targeting sgRNA (sgLacZ) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
Plasmid#85756PurposeAll in one plasmid that expresses Csy4, S.pyogenes FokI-dCas9-NLS, and GFP. Also encodes for multiplexed gRNAs. Backbone derived from pSQT1601 (Addgene #53369).DepositorInsertsCsy4-T2A-SpRFN-P2A-GFP
gRNA
UseCRISPRTagsCsy4, Csy4 recognition sequence, FokI fusion via …ExpressionMammalianMutationD10A, H840APromoterCMV and U6Available SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC014_pLKO-U6-BsmBI-MS2sgRNA-EFS-Thy11-2A-MS2-p65-HSF1
Plasmid#192187PurposeTdgA vectorDepositorTypeEmpty backboneExpressionMammalianMutationNAAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only