We narrowed to 1,697 results for: CAG promoter
-
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuideFUT3-neo
Plasmid#250304PurposeEncodes gRNA targeting FUT3DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
sUPRa
Plasmid#223242PurposesUPRa is a dual promoter and two-color construct, which is designed to report the global unfolded protein response (UPR) and affords unbiased cell detection irrespective of UPR levelsDepositorInsertsUPRa
UseAAVPromoterCustomAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-TG
Plasmid#40026DepositorInsertsT (ATG)
beta-globin intron
Neo
GFP
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides 1-274 and insertion of FRT, …PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(LNL)
Plasmid#36908DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT267_(pCA-ATG-intron-tTA2-TRE-tdT3Myc)
Plasmid#36879DepositorInsertstTA2
tdT-3Myc
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only