We narrowed to 2,509 results for: control GFP
-
Plasmid#170917PurposeExpresses FLAG-BirA-eGFP-NLS2 to be used as control in BioID or FLAG pull downDepositorInsertFLAG-BirA-eGFP-NLS2
TagsBirA-FLAGExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-DsRed_IRES_EGFP
Plasmid#92194PurposeLentiviral overexpression vector to make stable bicistronic cell line for control (EGFP) screenDepositorInsertDsRed-IRES-EGFP
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX
Plasmid#181873PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoterDepositorInsertsUseAAV and AdenoviralTagsHA and mycExpressionMammalianPromotersynthetic hybrid CAG promoter and synthetic hybri…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX GFP-HA
Plasmid#229501PurposeControl HA-tagged protein for immunoprecipitation experiments.DepositorInserteGFP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP
Plasmid#166143PurposeEGFP expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-dt/deltaEGFP
Plasmid#163919PurposePGK-driven dTomato expression. Lacks the CBA-promoter controlling EGFP expression.DepositorInsertdtomato
UseLentiviralExpressionMammalianMutationWTAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk(R28C)-GFP
Plasmid#51464PurposeNon-PIP3 binding control for PH-Btk-GFPDepositorAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-mEGFP-dspB(E184Q W330Y)-6xHis
Plasmid#176575PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV UBC OSBP(PH)-APEX2-3xFLAG-IRES-eGFP
Plasmid#218637PurposeProximity biotinylation control of OSBP(PH domain)DepositorInsertOSBP (OSBP Human)
UseLentiviralTagsAPEX2-3xFLAGExpressionMammalianMutationPH domain onlyPromoterUBCAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eGFP-Cre
Plasmid#120219PurposeExpresses cre under the control of CamKIIa promotorDepositorInsertcre
UseAAV and Cre/LoxTagsEGFPAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p415 TEF roGFP2‐Tsa2ΔCR
Plasmid#83238PurposeThe genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For cytosolic expression.DepositorInsertroGFP2-Tsa2dCr
TagsroGFP2 fusion with Tsa2dCrExpressionYeastPromoterTEFAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfralpha-EGFPN D842V
Plasmid#66789PurposeExpression of constitutively active murine PDGFRalpha D842V tagged with GFP under the control of EF1a promoterDepositorInsertPDGFRalpha (Pdgfra Mouse)
TagsEGFPExpressionMammalianMutationD842V (constitutively active)PromoterEF1aAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRE/VEGF/IRES/EGFP
Plasmid#206211PurposeAn expression vector of VEGF and EGFP under control of TRE promoterDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro GFP shRNA
Plasmid#10675PurposeNegative control vector for pMKO.1 puro (Addgene plasmid #8452); Contains shRNA against GFP.DepositorInsertGFP shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only