We narrowed to 22,832 results for: Ide
-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1958
Plasmid#82569PurposeHigh copy number plasmid containing PR2/3:Con MiniPromoter insert.DepositorInsertPRS2/3:Con
UsePleiades promoter project [sic, pleaides plieades]Available SinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB-CAG-rNanog-pgk-hph
Plasmid#74917PurposeMammalian expression of rNanogDepositorAvailable SinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
NKIRAS2
Plasmid#55676Purposeexpression of mouse NKIRAS2DepositorAvailable SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
NKIRAS1
Plasmid#55675Purposeexpression of mouse NKIRAS1DepositorAvailable SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Mrpl11-mod
Plasmid#49569Purposecontains Renilla Luciferase gene preceded by a mutated (ATG --> TTG) upstream open reading frame elementDepositorInsertMrpl11-mod
UseLuciferaseMutationT/A mutation in ATG start siteAvailable SinceDec. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-p85α_wt
Plasmid#39501DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1112
Plasmid#29041PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1144
Plasmid#29060PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1143
Plasmid#29059PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1266
Plasmid#29138PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1519
Plasmid#29253PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorInsertPle48 (DBH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 21, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1520
Plasmid#29254PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorInsertPle49 (DBH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 21, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
DCT.VV.Orf226
Plasmid#12914PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf226
ExpressionMammalianAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf67
Plasmid#12755PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf67
ExpressionMammalianAvailable SinceDec. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-nCas9(D10A)-PolI5MΔ
Plasmid#249069PurposeExpresses nucleus-localized nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertnCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
SLX4IP-SFB
Plasmid#247871PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged SLX4IPDepositorInsertSLX4IP (C20orf94 Human)
TagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
JAK1-NanoLuc Fusion Vector
Plasmid#238880PurposeExpress JAK1-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoterDepositorAvailable SinceSept. 16, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(SapI)-EFS-CasRx-pA
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only