We narrowed to 88,229 results for: son
-
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits
-
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/BLM
Plasmid#111766PurposeTo express human BLM protein in human cellsDepositorInsertBLM (BLM Human)
TagsFlag epitope tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys…ExpressionMammalianPromoterCMVAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR100
Plasmid#187240PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP_Rab35 Q67L active
Plasmid#47425DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep152
Plasmid#136825PurposeMammalian expression of the centrosomal protein Cep152 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep152 (CEP152 Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2115
Plasmid#49140PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
Gene Trap - 24XPP7 Lentiviral Vector
Plasmid#174199PurposeLentiviral expression vector coding for Blasticidin, iRFP and 24X PP7 hairpins. All inserts are cloned in on the -strand to allow for splicing in when targeted into an intron of transcribed genes.DepositorInsertiRFP
UseLentiviral; VectorTags24X PP7 hairpins, Blasticidin, and T2AExpressionMammalianAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SopB
Plasmid#183657PurposeN-terminally tagged Salmonella Typhimurium SopB for mammalian expressionDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro1 E208K/E328K
Plasmid#47894PurposeExpresses myc tagged Miro1 E208K/E328K mutantDepositorInsertMiro1 E208K/E328K (RHOT1 Human)
TagsmycExpressionMammalianMutationE208K/E328K, abolishes calcium bindingPromoterCMVAvailable SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICE-FLAG-NAT10-siR-G641E
Plasmid#59366PurposePlasmid for constitutive or doxycycline-inducible expression of G641E mutant of human NAT10 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertNAT10 NM_024662 (NAT10 Human)
TagsFLAGExpressionMammalianMutationG641E and silent mutations to render the cDNA res…PromoterCMV-tetAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCS4 3XFLAG-PPARgamma2
Plasmid#78770PurposeTo overexpress PPARgamma2 in Mammalian CellsDepositorAvailable SinceJune 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1_RAF1 (51-131)
Plasmid#119218Purposepurification of GST-RAF1 RBD from E. coliDepositorInsertRAF1 aa 51-131 (RAF1 Human)
ExpressionBacterialAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gα12-LgB115
Plasmid#134363PurposeNanoluc complementation assay. Expression of Gα12 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 115 and 116 of Gα12.Addition of the HA epitope at N terminus of Gα12.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP KNL1 wt hardened and RVSF->AAAA
Plasmid#45225DepositorInsertGFP KNL1 with RVSF-AAAA mutation, resistant to KNL1 siRNA (KNL1 Human)
MutationRVSF mutated to AAAAAvailable SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab35 S22N inactive
Plasmid#47426DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only