We narrowed to 19,542 results for: Tec
-
-
-
pGEX-KG/Net1A
Plasmid#28261DepositorAvailable SinceApril 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal-RNQ1 L94A-YFP
Plasmid#18692DepositorInsertRnq1 L94A (RNQ1 Budding Yeast)
TagsYFPExpressionYeastMutationLeucine 94 mutated to Alanine (L94A)Available SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby
Plasmid#71760PurposemGFP and Synaptophysin-mRuby expression from Cre-expressing neuronsDepositorHas ServiceAAV1InsertsmGFP
Synaptophysin
UseAAV and Cre/LoxTagsPalmitoylation signal and mRubyAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMK381 (AAVS1 CMV-OsTIR1F74G)
Plasmid#140536PurposeAAVS1 CMV-OsTIR1(F74G)DepositorInsertCMV-OsTIR1(F74G)
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
ND4.2-Right DdCBE-G1397-C- T1413I-GFP
Plasmid#179686PurposeExpression of base editor in mammalian cells and for cell sortingDepositorInsertSOD2 MTS_3xHA_ND4.2 Right TALE_2aa_DddA G1397-C (T1413I)_1xUGI_P2A_GFP_ATP5B 3'UTR
ExpressionMammalianMutationT1413IAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-blueCKAR
Plasmid#118472PurposecpBFP-based single-color biosensor for monitoring Protein Kinase C activity.DepositorInsertblueCKAR
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
