We narrowed to 16,593 results for: grna
-
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
p-dCas9-SSAP-MS2-BB_BbsI
Plasmid#183826PurposepU6-MS2-gRNA-backbone(BbsI)-CBH-dSpCas9-T2A-EBFPDepositorInsertU6-guideRNA-dCas9-T2A-EBFP
UseCRISPRExpressionMammalianPromoterCBHAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ146-ZmUbi-tRNA
Plasmid#158404PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ136-tRNA2.0; assembly of 6 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Dicer1
Plasmid#14763DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
px330-mcherry
Plasmid#98750PurposeCas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B2.0
Plasmid#167158PurposeGolden Gate entry vector to express the 4th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-p53-shRNA-941
Plasmid#25637DepositorAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-EGFP-mir30(Scn9a-scrambled)
Plasmid#79671PurposeScrambled control for Cre-dependent knockdown of Scn9a (Nav1.7)DepositorInsertEGFP
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shLKB1-Ms
Plasmid#61231PurposeLentivirus expressing shRNA to mouse LKB1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi_Mxi1_yl_NHEJ
Plasmid#91249PurposeCRISPRi vector for Yarrowia lipolytica, repressing KU70 and KU80 for enhanced HRDepositorInsertsCodon optimized dCas9-Mxi1
KU70 sgRNA expression cassette
KU80a sgRNA expression cassette
KU80b sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWL502-crRNA
Plasmid#174383PurposeThe plasmids carrying a mini-CRISPR array were used to express crRNAs; article demonstrates use in Haloferax mediterraneiDepositorInserta crRNA targeting the template strand
UseCRISPR; Archaeal expressionExpressionBacterialPromoterPhaR promoterAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet1
Plasmid#85742PurposeshRNA against mouse Tet1DepositorInsertshRNA Tet1
UseAAVTagsEYFPAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B2.0
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAT15516_BEAR-GFP-2in1
Plasmid#174082PurposeBEAR-GFP plasmid with a gRNA that targets its own plasmidDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianMutationdisrupted 5' splice sitePromoterCMVAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only