We narrowed to 6,655 results for: GCA;
-
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
G-CaMP3
Plasmid#22692Purposea single-wavelength GCaMP2-based genetically encoded calcium indicatorDepositorInsertG-CaMP3
ExpressionMammalianMutationN363D mutation (increased fluorescence)Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
SlugABEmax
Plasmid#163798PurposeExpresses ABEmax and nSlugCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianMutationSlugCas9 (D10A)Available SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDrop
Plasmid#184872PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for in-vivo excision of transferred DNA for homologous recombination and counter-selection for successful integration.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SlugBE4max
Plasmid#163799PurposeExpresses AncBE4max and nSlugCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianMutationSlugCas9 (D10A)Available SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-B
Plasmid#177812PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-A
Plasmid#177784PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only