We narrowed to 1,480 results for: cag promoter
-
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL3-sgRNA #2 (ATL3 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
UseTagsHA and YFP (Venus)ExpressionMammalianMutationPromoterCAG promoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
UseTagsECFP and FLAGExpressionMammalianMutationPromoterCAG promoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knoc…TagsExpressionMammalianMutationPromoterTRE3GS inducible promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorInserthuman CD14 (CD14 Human)
UseTagsExpressionMammalianMutationPromotermouse Hb9 (Mnx1) 9kb promoter fragmentAvailable sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBGFAP-eGFP
Plasmid#40975DepositorInsertMouse GFAP promoter fragment
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
UseTagsExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
SBC015866
Plasmid#226280PurposeExpresses BsSfp, MsCAD, and SrCAR from trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
UseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL2-sgRNA #1 (ATL2 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -