We narrowed to 14,283 results for: cas9
-
Plasmid#201591PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX4
Plasmid#183903Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PUbAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX3
Plasmid#183904Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE673
Plasmid#153239PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE670
Plasmid#153236PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR418
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #2
Plasmid#61514Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgccgctcccggatctcctgc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHEE901-A3A
Plasmid#229044PurposenCas9 mediated-base editing with NGG PAM recognition motif in Arabidopsis. A3A-nCas9-UGI includes D10A in Cas9.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmcGAS
Plasmid#208385PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine cGAS gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1_2 in PspCas13b-NES-lentiCRISPRv2-PuroR
Plasmid#255847PurposesgAAVS1_2 (Cas9) and PspCa13b-NES expressionDepositorAvailable SinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
sgDUSP11_1 in PspCas13b-NES-lentiCRISPRv2-PuroR
Plasmid#255849PurposesgDUSP11_1 (Cas9) and PspCa13b-NES expressionDepositorAvailable SinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only