We narrowed to 20,724 results for: ACE;
-
Plasmid#73556Purposevector encoding a fusion protein between PML-IV and ER (estrogen receptor)DepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLV-EF1a-V5-Sec61B
Plasmid#120244PurposeExpresses V5-tagged Sec61B in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
CD200RCd4d3+4-blac
Plasmid#32407PurposeA positive control receptor bait (rat CD4d3+4-blac) and prey (rat CD200 receptor) EXPRESs plasmid for The Basic AVEXIS kitDepositorInsertCD200 Receptor extracellular domain (Cd200r1 Rat)
TagsCd4d3+4 and beta-lactamaseExpressionMammalianPromoterCMVAvailable SinceJan. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
CDK4mut(K35M)-3XFlag-pBabe
Plasmid#73559Purposevector encoding a fusion protein between a CDK4 mutant (K35M) and 3 Flag tagsDepositorInsertCDK4mut(K35M)
UseRetroviralTags3X-FLAGExpressionMammalianPromoterSV40Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_mCherry::Nrv1::vhhGFP4
Plasmid#163926PurposeExpression of GrabFP-B-intracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (intracellular) nanobody with Nrv1 protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Vrk2
Plasmid#120240PurposeExpresses V5-tagged Vrk2 in lentiviral vectorDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pONSY
Plasmid#111873Purpose"Capsaspora owczarzaki" expression vector (backbone) modified from the pCR2.1. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807).DepositorTypeEmpty backboneUseCapsaspora owczarzakiPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWL502-PAM
Plasmid#174382PurposePlasmids bearing protospacer sequences with functional PAM efficiently triggered CRISPR-mediated defense in cells with corresponding spacer sequence; article demonstrates use in Haloferax mediterraneiDepositorInsertPAM-spacer
UseCRISPR; Archaeal expressionExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-Tev-MS2-p65-HSF1
Plasmid#84513PurposeMESA protease chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, and Tev protease, MS2-P65-HSF1DepositorInsertsV2-MESA-35F-Tev
MS2-P65-HSF1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW105
Plasmid#111137PurposeFor the expression of rat AANAT with Met-Leu-Ser N-terminus in S. cerevisiaeDepositorAvailable SinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-CD4-Sema4D
Plasmid#51603Purposeexpresses Sema4D/CD4 chimera with intracellular Sema4D, extracellular CD4DepositorInsertCD4-Sema4D
TagsmycExpressionMammalianMutationSema4D amino acids 1-754 have been replaced with …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT1100
Plasmid#8618DepositorInsertribonuclease Sa3, barstar
TagsphoA signal sequence to RNase Sa3ExpressionBacterialMutationIn addition to the substitution of the barnase ge…Available SinceJan. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-TEVcs-LaccID-myc_pCTCON2
Plasmid#234049Purposeexpresses LaccID on the yeast surfaceDepositorInsertAga2p-LaccID
ExpressionYeastAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs):GFP
Plasmid#218570PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM4_14
Plasmid#183062PurposePlasmid expressing a biosensor for acetic acid: BM3R1-Haa1-mTurquoise2 under RET2p and mCherry under HREsYGP1p with flanks for genome integration into HO locusDepositorInsertsmCherry
BM3R1-HAA1-mTurquoise2
UseSynthetic BiologyTagsmCherry and mTurquoise2ExpressionYeastPromoterHREsYGP1p and RET2Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2S
Plasmid#185865PurposeKnocking out ALD6 and expressing anacetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP ) in Saccharomyces cerevisiaeDepositorInsertALD6 (-125, 40)> PADH1> Lr.pduP> TPDC1-ALD6 (1054, 1749)
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Pigb-V5
Plasmid#175160PurposeLentiviral expression of mouse Pigb-V5DepositorAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term MBP SMT3 NikJC199U
Plasmid#174363PurposeExpression plasmid with a ULP1 removable N-term MBP SUMO tag, a TEV removable C-term 8xHis tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, MBP, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only