We narrowed to 81,743 results for: Mycs

#107916

URA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer

Jean-Marc Daran

Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov

April 18, 2018

Academic Institutions and Nonprofits only

#126448

To integrate the CHYRON3 locus at AAVS1 in human cells.

Chang Liu

Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. d

June 4, 2019

Academic Institutions and Nonprofits only

#219749

DVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expression

Alexander Mishin

Shakhova et al Nat Methods. 2024 Mar;21(3):406-410. doi

July 12, 2024

Academic Institutions and Nonprofits only

#87870

Express a EGFP-human GATE-16 in mammalian cells

Eiki Kominami, Isei Tanida

Tanida et al J Biol Chem. 2001 Jan 19;276(3):1701-6.

Aug. 6, 2019

Academic Institutions and Nonprofits only

#107923

TRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer

Jean-Marc Daran

Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov

April 18, 2018

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#107921

nat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer

Jean-Marc Daran

Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov

June 5, 2018

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#140764

Expresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2

Hideyuki Okano

Yoshimatsu et al Neurosci Res. 2019 Oct 3. pii: S0168-010

July 23, 2020

Academic Institutions and Nonprofits only