We narrowed to 4,657 results for: IRES
-
Plasmid#112310PurposeCRISPR donor plasmid to tag human transcription factor CLOCK with GFPDepositorInsertCLOCK homology arms flanking EGFP-IRES-Neo cassette (CLOCK Human)
UseCRISPRMutationhg38:4:55435551:A>G, hg38:4:55435749:G>AAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-FAB(PX-LD)
Plasmid#214422PurposeDetection of peroxisome-lipid droplet contact siteDepositorInsertPMP34-FKBP-V5-RspAN_IRES_CFAST-20nm-Halo-6xHp NC (SLC25A17 Human)
UseLentiviralTagsCFAST-Halo and FKBP-V5-RspANPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMTF1-donor
Plasmid#113829PurposeCRISPR donor plasmid to tag human transcription factor MTF1 with GFPDepositorInsertMTF1 homology arms flanking EGFP-IRES-Neo cassette (MTF1 Human)
UseCRISPRAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMYs-MFN2-IRES-mitoRFP
Plasmid#121997PurposeExpression of MFN2 and mitoRFP in mammalial cellsDepositorInsertMFN2-IRES-mitoRFP (MFN2 Human)
UseRetroviralMutationsilent Q386Q Q387Q V388V Y389Y C390C E391E E392EAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTag-BFP-C-h-Rab5a-c-Myc
Plasmid#79801PurposeExpress TagBFP labeled human Rab5a (GTPase located on early endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-GFP-WTUBA7-IRES-mcherry
Plasmid#246475PurposeMammalian expression of AcGFP-tagged WT human UBA7, co-expresses mCherry; for transfectionDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-NLS-mClover3-IRES-Puro
Plasmid#215544PurposeDonor plasmid for knock-in P2A-NLS-mClover3 into the human SOX2 locusDepositorInsertSOX2 homologous recombination arms with IRES-Puro selection cassette (SOX2 Human)
UseCRISPRAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-DIO-P-EF1a-RPL22-3xHA-IRES-YFP
Plasmid#170327PurposeDouble-floxed inverse Orientation HA and IRES-YFP tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPA70-IRES-RPA32-IRES-RPA14
Plasmid#211432Purposemammalian expression of human RPA70 and RPA32 and RPA14DepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES G418
Plasmid#110344Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQY527A-IRES-mCherry
Plasmid#166951PurposeLentiviral plasmid expressing GFP-tagged SFPQ Y527A protein with IRES-mCherry from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsGFP and mCherryMutationSFPQ-Y527APromotereF1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS rat IRS-1
Plasmid#11027DepositorInsertIRS-1 (Irs1 Rat)
ExpressionBacterialAvailable SinceMarch 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTag-RFP-C-h-Rab11a
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CBh-mKate2-IRES-MCS (WT-WT) (AAV2)
Viral Prep#105921-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CBh-mKate2-IRES-MCS (WT-WT) (#105921). In addition to the viral particles, you will also receive purified pAAV-CBh-mKate2-IRES-MCS (WT-WT) plasmid DNA. Control mKate2 expression AAV with two wild-type ITR sequences. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCBh and same CBh promoter as mKate2TagsmKate2Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mRor2WT
Plasmid#22613DepositorAvailable SinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only