We narrowed to 3,055 results for: SRS
-
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn HK1
Plasmid#220915PurposeNeuronal specific expression of HK1DepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-ABE8e(V106W)
Plasmid#198556PurposeExpresses human codon-optimized SpCas9-NRCH-ABE8e(V106W) and blasticidin resistance: EFS promoter-SpCas9-NRCH-ABE8e(V106W)-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-ABE8e(V106W)
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
p221a-GUS
Plasmid#71263PurposeEntry clone containing the GUS enzyme. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGateway CloningAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMP71-super-IL-2
Plasmid#174599PurposeExpresses extracellular domain of human IL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F) developed by the Garcia LabDepositorInsertextracellular domain of huIL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F)
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huAsCpf1
Plasmid#90095PurposeBacterial expression plasmid for protein purificationDepositorInserthuAsCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AausFP1
Plasmid#129499PurposeExpresses AausFP1 constitutively in E. coli (most strains)DepositorInsertAausFP1
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-BAIAP2 wt
Plasmid#31675DepositorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BFP
Plasmid#25891PurposeGateway entry vector containing BFP.DepositorInsertBFP
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huLbCpf1
Plasmid#90096PurposeBacterial expression plasmid for protein purificationDepositorInserthuLbCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PCS2-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124431PurposeExpresses FlipGFP (caspase-3 cleavage sequence) protease reporter and T2A mCherry in zebrafishDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
UseZebrafish (if expression level is too high in zeb…Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO-mcherry-luc-puro-TRPM1 cDNA
Plasmid#29782DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVNeoDEST(705-1)-hAXL
Plasmid#124796PurposeExpresses AXL in mammalian cellsDepositorAvailable SinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQE-80L 2xHis-LRRK2 Armadillo 1-552
Plasmid#186017Purpose2xHis-LRRK2 Armadillo 1-552DepositorInsert2xHis-LRRK2 Armadillo 1-552 (LRRK2 Human)
ExpressionBacterialAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
VAMP7 HA-delta pMEP4
Plasmid#62958Purposefull length human VAMP7 with C-terminal HA tag cloned into delta pMEP4DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only