We narrowed to 1,471 results for: tetracycline
-
Plasmid#208771PurposeTetracycline inducible expression vector for HA-JLP_V55Q mutant protein, used as a donor plasmid for HA-JLP_V55Q knock-in at the human ROSA26 locusDepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA5-FRT-TO-nsp7
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH666
Plasmid#169610PurposeTier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven TtgA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH664
Plasmid#169608PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven rtTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH663
Plasmid#169607PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven tTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMflCT-o4
Plasmid#101313PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and cat resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
cat resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflT-o1
Plasmid#101309PurposeContains: oriC1 fragment of M. florum L1 replication origin (rpmH/dnaA intergenic region), colE1 replication origin, recoded tetM resistance gene, origin of transfer of RP4 plasmid.DepositorInsertoriC1 of M. florum strain L1 (rpmH/dnaA intergenic region)
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
C0040 (tetR)_CD
Plasmid#66027PurposeMoClo Basic Part: CDS - Controller protein, tetR repressor (represses pTet, C0040. can be inhibited by tetracyclin or aTc) [C:C0040:D]DepositorInsertTranscription factor
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_AB
Plasmid#66008PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [A:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_EB
Plasmid#66009PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [E:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_FB
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
BS-TRP1-TetOff(7repeats)-GFP-Pho8
Plasmid#207011PurposeTet-Off controlled GFP-Pho8 with TRP1 selection. Tetracycline-controlled transactivator (tTA) present on same plasmid.DepositorInsertPho8
TagsGFPExpressionYeastAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87828PurposeHigh-efficient mammalian expression vector for co-expression of EGFP-tagged and mCherry-tagged proteins using P2AT2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV ATF4(5'UTR)-SunTag-Renilla-FKBP-Stop-24xMS2v5-CTE-polyA
Plasmid#164615PurposeExpresses ATF4(5'UTR)-SunTag-Renilla mRNA reporter under tetracycline-inducible promoter. SunTag and Renilla luciferase are in frame with the main start codon of ATF4.DepositorInsertRenilla luciferase
Tags24xMS2v5 (3'UTR) and SunTagExpressionBacterial and MammalianPromoterTetCMVAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human MAC-1 alpha
Plasmid#8631DepositorInsertMAC-1 alpha (ITGAM Human)
ExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pQFmcs-2H12.D11-scarREF
Plasmid#221184PurposecdGreen2 expressed from a cumate-inducible promoter in an operon with mScarlet-I (downstream) as a reference FP (Internal Lab ID: UJ11240)DepositorInsertscdGreen2
mScarlet-I
ExpressionBacterialMutationN-terminus changed: starts with MSKKYGEAVIKE ...PromoterNone (same as cdGreen2) and PQ5 (cumate-inducible)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-TRE-CMV-Cre-rtTA
Plasmid#165457PurposeTetracycline inducible CRE expression from AAVS1 locusDepositorInsertCRE
ExpressionMammalianPromoterTight TRE promoterAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDule-para-aminoPhe
Plasmid#85502PurposePlasmid for incorporating the non-canonical amino acid para-aminoPhe with the Mj pAF synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertp-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32T, E107T, D158P, I159L, L162APromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only