We narrowed to 1,490 results for: tox
-
Plasmid#184499PurposeExpresses the L14P mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationL14PPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-S172L-FLAGC
Plasmid#161904PurposeExpresses the catalytically inactive S172L mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianMutationS172L; catalytically dead mutantPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B G579S
Plasmid#239213PurposeExpresses CDK11B with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58
Plasmid#239215PurposeExpresses CDK11B p58 isoform in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A
Plasmid#239217PurposeExpresses CDK11B with D562A kinase inactivating mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to AlanineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58 G579S
Plasmid#239216PurposeExpresses CDK11B p58 isoform with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B p58 isoform with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A, G579S
Plasmid#239218PurposeExpresses CDK11B with D562A kinase inactivating mutation and G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation and G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to Alanine and changed …Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPMS-2272
Plasmid#232292PurposeProtein ExpressionDepositorInsertAlpha bungarotoxin
ExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
DH5alpha::DddI
Bacterial Strain#179631PurposeFor expression of toxic DddADepositorBacterial ResistanceGentamicinAvailable SinceOct. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-22b DT 51E/148K
Plasmid#11081DepositorInsertDT
TagsHisExpressionBacterialMutation51E/148K, catalytically inactiveAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBP-C_sacB
Plasmid#204113PurposeType 0 CDS partDepositorInsertToxic levansucrase sacB
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-C_ccdB
Plasmid#204114PurposeType 0 CDS partDepositorInsertToxic DNA gyrase inhibitor ccdB
ExpressionBacterialMutationNoneAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
C98m
Plasmid#121002PurposeMoClo golden gate assembly CD part for Gp2 (RNA polymerase inhibitor from T7 phage; lethal to host when expressed). Please see Supplemental Documents for annotated Genbank file.DepositorInsertGp2 toxin
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pQE-60NA-mScarlet-2I
Plasmid#160463PurposeEncodes a variant of mScarlet-I that displays reduced cytotoxicity in bacteriaDepositorInsertmScarlet-2I
ExpressionBacterialPromoterT5Available SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE-60NA-mCherry2C
Plasmid#160461PurposeEncodes an mCherry variant that displays lower cytotoxicity in bacteriaDepositorInsertmCherry2C
ExpressionBacterialPromoterT5Available SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only