We narrowed to 17,846 results for: 110
-
Plasmid#110266PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only
-
KG#371
Plasmid#110882PurposeExpresses the lysosome marker CTNS-1-mCherry cDNA in a subset of ventral cord cholinergic motor neuronsDepositorInsertsunc-129 promoter
CTNS-1a-mCherry cDNA
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
Tagsintron-mCherryExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMINTC3GH (Apr)
Plasmid#110078PurposeAnalogous to pMINTNH3 but with a C-terminal 3C cleavage site and a GFP-His10 tag fusion.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SERPINA5_Serpin
Plasmid#110034PurposeProtein expression and purification of SERPINA5_SerpinDepositorInsertSERPINA5_Serpin (SERPINA5 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBTK601
Plasmid#110607PurposeBTK assembled plasmid - encodes Cas9 with no targeting sgRNA (used with suicide plasmid for broad-host-range genome alteration)DepositorInsertCas9
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PFN2_Profilin
Plasmid#110007PurposeProtein expression and purification of PFN2_ProfilinDepositorInsertPFN2_Profilin (PFN2 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
B. fragilis 16S toehold switch sensor
Plasmid#110696PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. fragilis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ACR_Trypsin
Plasmid#110042PurposeProtein expression and purification of ACR_TrypsinDepositorInsertACR_Trypsin (ACR Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
plko-puromycin-shTRX1-259
Plasmid#110921PurposeTo knockdown Thioredoxin-1DepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E WT
Plasmid#110123PurposeExpresses Flag-tagged D. melanogaster Hel25EDepositorAvailable SinceOct. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E K91N
Plasmid#110121PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationK91N mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E D193E
Plasmid#110120PurposeExpresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationD193E mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#65
Plasmid#110933PurposeExpresses proteins in cholinergic neurons in the ventral nerve cord of C. elegansDepositorInsertsunc-17 beta promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK300
Plasmid#110592PurposeBTK Type 4 terminator for golden gate assemblyDepositorInsertrpoC
UseSynthetic BiologyAvailable SinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1_MeCP2(R111G)
Plasmid#110187PurposeExpression of mouse MeCP2 (R111G) in mammalian cellsDepositorInsertMeCP2_e2 FL [R111G] (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationArg 111 GlyPromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS314-hUD
Plasmid#11005DepositorInserthUD recombination system
ExpressionBacterial and YeastMutationDirect repeat recombination system. Recombination…Available SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-TFAP4(E135A/S139A)
Plasmid#110157PurposeExpression of human TFAP4 (E135A/S139A) in mammalian cellsDepositorInsertTFAP4 (transcription factor AP-4) (TFAP4 Human)
TagsHAExpressionMammalianMutationE135A/S139APromoterCMVAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PRKACA_C1+C2
Plasmid#110027PurposeProtein expression and purification of PRKACA_C1+C2DepositorInsertPRKACA_C1+C2 (PRKACA Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3GH (Apr)
Plasmid#110083PurposeAnalogous to pMINTC3GH but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only