We narrowed to 9,093 results for: sgRNA
-
Plasmid#234495PurposeHYGR-CnU6-empty sgRNADepositorInsertHYG-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T1_gRNA
Plasmid#199387PurposepDEL111; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type I sgRNADepositorInsertnrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T2_gRNA
Plasmid#199388PurposepDEL112; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type II sgRNADepositorInsertnrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T3_gRNA
Plasmid#199389PurposepDEL113; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type III sgRNADepositorInsertnrg1 type III sgRNA
UseTol2 destination vectorAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sp(AU)sgRNA-mKO2
Plasmid#184443PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection markerDepositorInsertsgRNA with AU flip, mKO2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1393
Plasmid#111430PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBR_Cas9_sp1
Plasmid#154851PurposeExpresses SpCas9 and sgRNA that targets the upp gene in Rhodobacter sphaeroides genomeDepositorInsertsSpcas9 gene
sgRNA scaffold
UseCRISPRTags6xHisMutationCodon harmonized variant for expression in Rhodob…Available SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-tdTomato
Plasmid#106949PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with tdTomato markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_hNT
Plasmid#71830PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cellsDepositorInsertNon-targeting sgRNA human (DNMT3A Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
ExpressionWormPromoterR07E5.16 U6 promoterAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBHM2644
Plasmid#229528PurposeCarries AID* tag, empty sgRNA, and NATR markerDepositorInsertAID* - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-EbpA_g1
Plasmid#153517PurposesgRNA for ebpA gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertpnisA-sgRNA(EbpA_g1)-dCas9 scaffold
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2656
Plasmid#248701PurposeZ. mobilis CRISPRi version 2, promoter C, empty guideDepositorInsertempty sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-FOXP2_sgRNA1-hUbC-dCas9-KRAB-T2a-GFP
Plasmid#231022PurposeAll-in-one lentiviral vector (Gersbach lab design) for CRISPRi targeting FOXP2DepositorInsertFOXP2 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-FOXP2_sgRNA2-hUbC-dCas9-KRAB-T2a-GFP
Plasmid#231023PurposeAll-in-one lentiviral vector (Gersbach lab design) for CRISPRi targeting FOXP2DepositorInsertFOXP2 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(CTRL)-hSyn-mCherry
Plasmid#231405PurposeCTRL knockdown gRNADepositorInsertsgRNA(CTRL)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVE-GhCLA
Plasmid#234929PurposeThis all-in-one vector is used to specifically knock out the GhCLA gene via virus-induced genome editing (VIGE).DepositorInsertGhCLA sgRNA
ExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only