We narrowed to 9,217 results for: sgRNA
-
Plasmid#194152PurposesgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, CarbR. Contains mrfp nontargeting control guide sequence.DepositorInsertsgRNA with mrfp control guide sequence
ExpressionBacterialPromoterJ23119Available sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgAdam10 v3
Plasmid#158047Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Adam10. NO Cas9DepositorInsertAdam10 sgRNA
ExpressionMammalianPromoterU6Available sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDAS12137_sgRNA-PEAR-GFP-nick(+17)-mCherry
Plasmid#177183Purposeplasmid expressing an sgRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBBR_Cas9_sp1
Plasmid#154851PurposeExpresses SpCas9 and sgRNA that targets the upp gene in Rhodobacter sphaeroides genomeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpcas9 gene
sgRNA scaffold
UseCRISPRTags6xHisMutationCodon harmonized variant for expression in Rhodob…Available sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC-mCherry-MLKL
Plasmid#75167PurposeLentiCRISPR-mCherry with sgRNA targeting human MLKLDepositorInsertMLKL sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBHM2616
Plasmid#234495PurposeHYGR-CnU6-empty sgRNADepositorInsertHYG-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T1_gRNA
Plasmid#199387PurposepDEL111; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type I sgRNADepositorInsertnrg1 type I sgRNA
UseTol2 destination vectorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T2_gRNA
Plasmid#199388PurposepDEL112; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type II sgRNADepositorInsertnrg1 type II sgRNA
UseTol2 destination vectorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T3_gRNA
Plasmid#199389PurposepDEL113; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type III sgRNADepositorInsertnrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sp(AU)sgRNA-mKO2
Plasmid#184443PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection markerDepositorInsertsgRNA with AU flip, mKO2
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-1
Plasmid#92156PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-EbpA_g1
Plasmid#153517PurposesgRNA for ebpA gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertpnisA-sgRNA(EbpA_g1)-dCas9 scaffold
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1393
Plasmid#111430PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-tdTomato
Plasmid#106949PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with tdTomato markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
ExpressionWormPromoterR07E5.16 U6 promoterAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBHM2644
Plasmid#229528PurposeCarries AID* tag, empty sgRNA, and NATR markerDepositorInsertAID* - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -