We narrowed to 3,492 results for: aaas
-
Plasmid#183554PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)DepositorInsertLuciferase shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_10bp 5'SS_No BP or pBP_pUC18
Plasmid#100989PurposeRp51a with a tGGTAtGTta->AGGTAAGTAT 5'SS mutant with potential to form 10bps with the U1 snRNA. Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationtGGTAtGTta->AGGTAAGTAT 5'SS mutant, TACTA…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_SUS1 5'ss_No_BP_pBP-pUC18
Plasmid#100990PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence). Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutant, TACTAAC->…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN2-exon7-ESE1
Plasmid#126042PurposeIn-vitro-transcription of SMN2-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN2 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
MLSE-shTAF12.376
Plasmid#105578Purposeretrovirally express TAF12 shRNA with GFP markerDepositorInsertTAF12 shRNA #376
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTAF4.2818
Plasmid#105563Purposeretrovirally express TAF4 shRNA with puro resistance and GFP markerDepositorInsertTAF4 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTAF2.4392
Plasmid#105562Purposeretrovirally express TAF2 shRNA with puro resistance and GFP markerDepositorInsertTAF2 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTAF12.376
Plasmid#105560Purposeretrovirally express TAF12 shRNA with puro resistance and GFP markerDepositorInsertTAF12 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_1
Plasmid#104044PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_2
Plasmid#104045PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCm7RNA6A
Plasmid#84367PurposeCas9-gRNA plasmid for mouse Cbfa2t2 m7 mutant knockinDepositorInsertCbfa2t2 m7-gRNA6
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MXW-PGK-c-let-7-LP4B-IRES-EGFP
Plasmid#37647DepositorInsertcel-let-7
UseRetroviralExpressionMammalianMutationLP4 - AATATTACCA=>AATAAAACCAPromotermPGKAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
MXW-PGK-c-let-7-LP4A-IRES-EGFP
Plasmid#37646DepositorInsertcel-let-7
UseRetroviralExpressionMammalianMutationLP4 - AATATTACCA=>AATAAAACCAPromotermPGKAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
MXW-PGK-c-let-7-LP4-IRES-EGFP
Plasmid#37643DepositorInsertcel-let-7
UseRetroviralExpressionMammalianMutationLP4 - AATATTACCA=>AATAAAACCAPromotermPGKAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shLKB1-Hu
Plasmid#61242PurposeLentivirus expressing shRNA to human LKB1DepositorInsertLKB1 (STK11 Human)
UseLentiviralAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDA_834
Plasmid#216087PurposeCas9 [Sp] knockout targeting CD59, positive controlDepositorInsertCD59 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEM394 - mosTI unc-119 - PUPN - NNN - tbb-2
Plasmid#182352PurposePan-neuronal expression cloning vector for mosTI(unc-119). Transgene inserted between Ultra pan neuronal (UPN) promoter and tbb-2 3'UTR. MCS or Golden Gate (BsaI: aaaa - MCS - tgag)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only