We narrowed to 1,550 results for: Green Fluorescent Protein
-
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
FR_GFP
Plasmid#31302DepositorInsertgreen fluorescent protein
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationPromoterPTETREGAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
UseTagsExpressionMutationIncludes full 819 bp coding sequence of URA3, 435…PromoterAvailable sinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
UseTagsExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
UseTagsHis tagExpressionMammalianMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
UseTagsExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
UseTagsN-terminal His6 tagExpressionBacterialMutationPromoterAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)IRES GFP
Plasmid#51406PurposeExpresses GFP from internal ribosome entry sequence, cloning componentDepositorInsertIRES GFP
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-GFP-W
Plasmid#196046Purposelentiviral expression of the green fluorescent protein driven by cytomegalovirus virus promoterDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMutationPromoterCMVAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/GFP
Plasmid#139980Purposeexpresses GFP under the promoter of CAG. Transgene flanked by AAV2 ITRDepositorInsertGreen fluorescent protein
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pReporter_8
Plasmid#60568PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_8
UseTagsExpressionBacterialMutationPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pReporter_3
Plasmid#60564PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_3
UseTagsExpressionBacterialMutationPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pReporter_4
Plasmid#60565PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_4
UseTagsExpressionBacterialMutationPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-EGFP
Plasmid#114213PurposeAAV vector (control) that targets expression of EGFP to neuronsDepositorInsertEnhanced Green Fluorescent Protein
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNonePromoterhuman synapsin (hSyn)Available sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pReporter_12
Plasmid#60572PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_12
UseTagsExpressionBacterialMutationPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-mMALAT1_3' WT Sense
Plasmid#46834PurposeExpress cGFP transcript ending in the wildtype MALAT1 triple helixDepositorInsertCoral Green Fluorescent Protein (cGFP)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPfor
Plasmid#158059PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the forward orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyTagsExpressionBacterialMutationPromoteracpPAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only