We narrowed to 14,589 results for: RON
-
Plasmid#149690PurposeFor packaging and expression of Chronos-mT-Sapphire in neurons via AAVDepositorInsertChronos
UseAAVTagsmT-SapphireExpressionMammalianPromoterhSynAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1360 - Intron GG3 - smu-1
Plasmid#159806PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1358 - Intron GG1 - smu-1
Plasmid#159804PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL649 CHYRON2 integration construct
Plasmid#126446PurposeTo integrate the CHYRON2 locus at AAVS1 in human cells.DepositorInsertspU6-CHYRON2 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/intron/FlagCter
Plasmid#113548PurposeMammalian expression plasmid that can be used with the Flp-In T-REx system.DepositorInsertFlag
TagsFlagExpressionMammalianAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT234_(pCA-G-intron-tTA2)
Plasmid#36874DepositorInsertsGFP
tTA2
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 myc Caronte (CT#612)
Plasmid#13861DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Chronos-mT-Sapphire-NRN
Plasmid#149692PurposeFor packaging and expression of Chronos-mT-Sapphire featuring a neuritin (NRN) 3' UTR in neurons via AAVDepositorInsertChronos
UseAAVTagsmT-SapphireExpressionMammalianPromoterhSynAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [Chronos-tdTomato]
Plasmid#122103PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
RON2-COMP-blac-flag-his
Plasmid#110962PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertrhoptry neck protein 2 (RON2) (PF3D7_1452000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
BFP-GFP-bidirectional MS2 splicing reporter FRG1-intron
Plasmid#235087PurposeGFP splicing reporter with FRG1 intronDepositorInsertBFP-GFP-bidirectional MS2 splicing reporter FRG1-intron (FRG1 Human)
UseAAVExpressionMammalianPromotercustom bidirectionalAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BFP-GFP-bidirectional MS2 splicing reporter CORO1B intron
Plasmid#235086PurposeGFP splicing reporter with CORO1B intronDepositorInsertBFP-GFP-bidirectional MS2 splicing reporter CORO1B intron (CORO1B Human)
UseAAVExpressionMammalianPromotercustom bidirectionalAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-JNKKTRrsGreenF-E-2A-ERKKTRrsFastLime-IRES-PKAKTRClover-2A-P38KTRDronpa
Plasmid#205766PurposeExpression of JNK KTR rsGreenF-E, ERK KTR rsFastLime, PKA KTR Clover, and P38 KTR Dronpa in mamalian cellsDepositorInsertJNK KTR rsGreenF-E-2A-ERK KTR rsFastLime-IRES-PKA KTR Clover-2A-P38 KTR Dronpa
UseAAVExpressionMammalianMutationwtAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Dlx5/6-Chronos-eGFP-p2a-nls-mScarlet
Plasmid#121543PurposeChronos with red nucleus-targeted fluorescence for inhibitory neuronsDepositorInsertblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet
UseAAVPromoterdlx5/6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-CAAX2 WPRE
Plasmid#236232PurposeAAV expression of a fluorescent marker, mScarletI, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmScarletI fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmScarletIPromoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_CoV-2_frD_S Omicron BA.2
Plasmid#253117PurposeFor recombinant virus rescue; encodes fragment D of SARS-CoV-2 (nt20950-29867), Wuhan backbone with Omicron BA.2 spike; chimericDepositorInsertSARS-CoV-2 Omicron BA.2 spike
ExpressionBacterialAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19_CoV-2_frD_S Omicron BA.1
Plasmid#253116PurposeFor recombinant virus rescue; encodes fragment D of SARS-CoV-2 (nt20950-29867), Wuhan backbone with Omicron BA.1 spike; chimericDepositorInsertSARS-CoV-2 Omicron BA.1 spike
ExpressionBacterialAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-RRV-intron
Plasmid#241902PurposeLbCas12a-RRV-intron Gateway entry plasmidDepositorInsertLbCas12a-RRV-intron
UseCRISPRTagsNLSExpressionPlantAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only