We narrowed to 10,399 results for: Ada;
-
Plasmid#105790PurposeExpression of your protein of interest in fusion with cyan fluorescent protein at the C-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCeruleanExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pKK-mCardinal-TEV
Plasmid#105781PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 24633408). mCardinal is suitable for deep-tissue imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsmCardinal-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mCerulean-TEV
Plasmid#105773PurposeExpression of your protein of interest in fusion with cyan fluorescent protein at the N-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmCerulean-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)∆CBM
Plasmid#100745PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertbeta2 adaptin (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi
Plasmid#89744PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Mouse, Synthetic)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-n
Plasmid#53065Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-n
Plasmid#53067Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-n
Plasmid#53071Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only