We narrowed to 1,708 results for: CAG promoter
-
Plasmid#254582PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and eGFP from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPN283
Plasmid#91666PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHes1-DsRed
Plasmid#13767DepositorInsertHes1 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNrl-DsRed
Plasmid#13764DepositorInsertNrl promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL1-3964
Plasmid#115459PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -