We narrowed to 10,703 results for: ada

#126513

Anion-conducting Channelrhodopsin with near-complete desensitization in continuous light. Codon-optimized for mammalian expression (human/mouse).

Peter Hegemann

Oppermann et al Nat Commun. 2019 Jul 25;10(1):3315. doi:

May 22, 2019

Academic Institutions and Nonprofits only

#117745

Open reading frame vector encoding DEDD

William Hahn

Hong et al Mol Cancer Res. 2019 Feb 18. pii: 1541-7

Feb. 21, 2019

Academic Institutions and Nonprofits only

#105798

Expression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV), (PMID: 24633408). mCardinal is suitable for deep-tissue imaging.

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#105790

Expression of your protein of interest in fusion with cyan fluorescent protein at the C-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#105781

Expression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 24633408). mCardinal is suitable for deep-tissue imaging.

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#105773

Expression of your protein of interest in fusion with cyan fluorescent protein at the N-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#85210

TRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#100745

Bacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutant

Stephen Royle

Wood et al J Cell Biol. 2017 Sep 27. pii: jcb.20170

Sept. 12, 2017

Academic Institutions and Nonprofits only

#89744

Expression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only

#82473

Expresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive form

Daniel Schoenberg

Mukherjee et al PLoS Biol. 2014 Aug 19;12(8):e1001933. d

Sept. 16, 2016

Academic Institutions and Nonprofits only