We narrowed to 14,589 results for: RON
-
Plasmid#48292DepositorTypeEmpty backboneTagsHis6 and ThioredoxinExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pLN189 (SSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105209PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 2 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69904PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PP_080_pAAV_CAG_DIO-LR-Voltron2-P2A-CheRiff-eGFP-ST (Kv2.1TS)
Plasmid#230990PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Voltron2 and soma-localized CheRiff
UseAAVExpressionMammalianPromoterCAGAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Sec61b WPRE
Plasmid#236229PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N), V1 and V2 Glycosylation sites
Plasmid#120407Purposeenables eukaryotic expression of human plasma fibronectin in which all three O-glycosylation sites were mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with mutations …PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
roGFP_iL_pQE30
Plasmid#48633PurposeBacterial expression vector encoding for the 6XHis tagged redox probe roGFPiL (roGFP C147, L147b, C204)DepositorInsertroGFP1
TagsHisTagMutationinsertion L147BAvailable SinceOct. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSEM396 - mosTI unc-119 - NNN - operon - gfp - tbb-2
Plasmid#182353PurposeGFP co-expression cloning vector for mosTI(unc-119). Transgene inserted upstream of gpd-2 operon::gfp::tbb-2 3'UTR. MCS or Golden Gate (BsaI: tgcc - MCS - tgag)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2211 - [1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
Plasmid#159866PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Sumo TEV cloning vector with BioBrick polycistronic restriction sites (9S)
Plasmid#48291DepositorTypeEmpty backboneTagsHis6 and SumoExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV 5'TOP intron 20xGCN4 Renilla FKBP Stop 24xMS2v5 SV40 CTE polyA
Plasmid#119946PurposeExpresses 5'TOP-SunTag-Renilla mRNA reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
Plasmid#163643PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.DepositorInsertsUseLentiviralTagsLuc2-P2A-tdTomato-T2AMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterEFS and pU6Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
Plasmid#247940PurposeAAV transfer plasmid encoding the human α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdDronpa1.2-Talin1(1974–2541)-mIFP
Plasmid#249168PurposeMammalian expression vector of talin1 C-terminal fragment fused with pdDronpa1.2DepositorInsertTalin1 (TLN1 Human)
TagsmIFP and pdDronpa1.2ExpressionMammalianMutationDeleted amino acids 1–1973PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-DjCas13d-pA
Plasmid#192498PurposeTo express DjCas13d in a Cre dependent mannerDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only