We narrowed to 19,542 results for: Tec
-
Pooled Library#82480PurposeThis library is intended to be used as a technical tool for removal of mitochondrial DNA from mouse genomic DNA preparations.DepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLKO5.sgRNA.EFS.GFP
Plasmid#57822Purpose3rd generation lentiviral Vector for Sp sgRNA delivery without SpCas9, GFP, EFS Promoter drivenDepositorInsertssgRNA
EFS
eGFP
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti Lifeact-iRFP670 BlastR
Plasmid#84385PurposeLentiviral expression of iRFP670-tagged Lifeact with Blasticidin selection in cells including neuronsDepositorInsertLifeact
UseLentiviralTagsiRFP670PromoterCMV immediate earlyAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
PEmax_2star_pet21A
Plasmid#227675PurposeExpression plasmid for PEMAX** protein in bacteria.DepositorInsertPEmax_2_star
UseCRISPRTagsHis-tagExpressionBacterialPromoterT7Available SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74G)
Plasmid#140730PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74G)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA050
Plasmid#216107PurposegDNA expression for Cas9 with ChenF+E trRNA (guide only)DepositorInsertgDNA expression for Cas9 with ChenF+E trRNA
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FLAG-MYO1D
Plasmid#125125PurposeExpresses human FLAG-MYO1DDepositorAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHTNW
Plasmid#136403PurposeExpression of N-terminal HaloTag-fused proteins in mammalian cells. Genes can be cloned using Gateway cloning system. Cloned vectors can be used for NanoBRET assay.DepositorTypeEmpty backboneTagsHaloTagExpressionMammalianPromoterCMVAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only