We narrowed to 18,895 results for: 110
-
Plasmid#110709PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. longum species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
F. prausnitzii 16S toehold switch sensor
Plasmid#110705PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertF. prausnitzii 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
R. hominis 16S toehold switch sensor
Plasmid#110703PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertR. hominis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
E. rectale 16S toehold switch sensor
Plasmid#110702PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertE. rectale 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. breve 16S toehold switch sensor
Plasmid#110701PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. breve 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. adolescentis 16S toehold switch sensor
Plasmid#110700PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. adolescentis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. longum 16S toehold switch sensor
Plasmid#110699PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. longum 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron 16S toehold switch sensor
Plasmid#110697PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. thetaiotaomicron 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_TAP
Plasmid#110240PurposeCre/Lox C-terminal tagging construct encoding the Twin Affinity Purification proteinDepositorTypeEmpty backboneUseCre/LoxAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_3HA
Plasmid#110233PurposeCre/Lox C-terminal tagging construct encoding 3 copies of the influenza virus hemagglutunin (HA) epitopeDepositorTypeEmpty backboneUseCre/LoxAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Met1 diUb (1-152, R42W)
Plasmid#110767PurposeBacterial expression of Met1 diUbDepositorAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE.puro/TO/Flag/HuR.S221D
Plasmid#110347PurposeDoxycycline inducible mammalian retroviral expression of HuR (S221D) with FLAG tagDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationS221D, P237SPromotergagAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK-ENH_BsmB1-MCS-Avi
Plasmid#110205PurposeRecipient vector for expression of C-terminally Avi-tagged protein of interest in chick embryos under the control of enhancer of choiceDepositorInsertENH_BsmB1-MCS-Avi
TagsAvi_tagExpressionBacterialAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Pet28a His6-HSPB7 (zebrafish) C49S
Plasmid#110071PurposeExpress C49S mutant of Zebrafish His6-HSPB7 in bacteriaDepositorInsertHis6-HSPB7 (hspb7 Zebrafish)
TagsHis6ExpressionBacterialMutationCysteine 49 to SerinePromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-IQCF2
Plasmid#110507PurposeFluorescent IQCF2DepositorAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_yECitrine
Plasmid#110231PurposeCre/Lox C-terminal tagging construct encoding codon-optimized yellow fluorescent proteinDepositorTypeEmpty backboneUseCre/LoxAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU71.2-2.2
Plasmid#110685PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4
ExpressionYeastAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only