We narrowed to 7,002 results for: tac
-
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV Syn Barcode16
Plasmid#226195PurposeExpression mappingDepositorInsertSyn Barcode16
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode13
Plasmid#226187PurposeExpression mappingDepositorInsertSyn Barcode13
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1956
Plasmid#188670PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1957
Plasmid#188674PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF-N-HiBiT-template
Plasmid#200882Purposetemplate for N-terminal HiBIT-taggingDepositorInsertHiBIT-linker
ExpressionMammalianMutationWTAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT22U6CatalE4PCh(#767)
Plasmid#184078Purposecyclofen-inducible Catalase activation in zebrafish permanent transgenicDepositorInsertCatalDeltaC-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes) + in vitro tra…MutationCatalDeltaC: deleted 516-527; ERT2: G400V, M543A,…PromoterZf-Ubi+SP6Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pBrain-GFP-shGL2
Plasmid#60004PurposeCo-expresses control GL2 shRNA and GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
SB53
Plasmid#21488DepositorAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_10bp 5'SS_No BP or pBP_pUC18
Plasmid#100989PurposeRp51a with a tGGTAtGTta->AGGTAAGTAT 5'SS mutant with potential to form 10bps with the U1 snRNA. Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationtGGTAtGTta->AGGTAAGTAT 5'SS mutant, TACTA…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_SUS1 5'ss_No_BP_pBP-pUC18
Plasmid#100990PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence). Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutant, TACTAAC->…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SPLICa:ER-MT (High Affinity)
Plasmid#247995PurposeExpresses the SPLICa reporter for ER-Mitochondria contacts and Calcium transients at the contactDepositorInsertSPLICa ER-MT (h)
ExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only