We narrowed to 12,110 results for: NSI
-
Plasmid#197814PurposeLevel 0 J1-J4 destination vector, BbsI entry & CcdB selectionDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMC-1-ccdB-11
Plasmid#197815PurposeLevel 0 J1-J11 destination vector, BbsI entry & CcdB selectionDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-H-RAN-RFP6
Plasmid#106426PurposeH-RAN-RFP6 (RANbody RFP6::Sm-HAtag)DepositorInsertH-RAN-RFP6
TagsHA, His, and Multiple HAExpressionMammalianAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYCTK025
Plasmid#176729PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Ste2 gene of Lachancea mirantina (receiver part).DepositorArticleInsertste2Lm
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK028
Plasmid#176732PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Ste2 gene of Tetrapisispora phaffii (receiver part).DepositorArticleInsertste2Tp
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIVURA MCP-GFPenvy
Plasmid#189940PurposeSingle-integration vector for integration of MCP-GFPEnvy at the URA3 locus in Saccharomyces cerevisiaeDepositorInsertMCP-GFPEnvy
ExpressionBacterialAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET26-CNTnw
Plasmid#100163Purposerecombinant expression of target protein as an MBP-His tag fusion at the N-terminus of target proteinDepositorInsertConcentrative nucleoside transporter
TagsMBP-HisExpressionBacterialPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL-Rbl2
Plasmid#20885DepositorAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJK220
Plasmid#71123PurposeExpression of E. coli pantotheinate kinase (H6PanK, R175H mutant) in E. coliDepositorInsertpantothenate kinase
TagsH6ExpressionBacterialMutationArg175 is mutated to a HisPromoterT7Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-3xHA-IκBα(1-62)
Plasmid#129226PurposeEncodes HA tagged human IκBα(1-62) for purification by GST affinityDepositorAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHJ1_Full length LexA
Plasmid#107237PurposesfGFP expression repressed by transcriptional factor LexADepositorInsertFull length LexA repressor
UseSynthetic BiologyPromoterpLacO1Available SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-H-RAN-H2A2B
Plasmid#106419PurposeH-RAN-H2A2B (RANbody H2A2B::Sm-HAtag)DepositorInsertH-RAN-H2A2B
TagsHA, His, and Multiple HAExpressionMammalianAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT225_(pCA-tdT3Myc)
Plasmid#36873DepositorInserttdTomato-3Myc
Tags3 Myc tagsExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYCTK009
Plasmid#176713PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor gene of Eremothecium cymbalariae (sender part).DepositorArticleInsertmfalpha1Ec
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK020
Plasmid#176724PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Ste2 gene of Eremothecium cymbalariae (receiver part).DepositorArticleInsertste2Ec
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK030
Plasmid#176734PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Bar1 gene of Candida albicans (barrier part).DepositorArticleInsertbar1Ca
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK031
Plasmid#176735PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Bar1 gene of Eremothecium cymbalariae (barrier part).DepositorArticleInsertbar1Ec
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK008
Plasmid#176712PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor gene of Candida albicans (sender part).DepositorArticleInsertmfalpha1Ca
UseSynthetic BiologyMutationCodon-optimized for expression in S. cerevisiaeAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL-Rbl1UTR
Plasmid#20884DepositorAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
RaCCR1_EYFP_pcDNA3.1
Plasmid#159122PurposeThis plasmid encodes RaCCR1 rhodopsin domainDepositorInsertRaCCR1
TagsEYFPExpressionMammalianAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJLI-sup35
Plasmid#1210DepositorInsertsup35 5' and 3' flanking regions (SUP35 Budding Yeast)
ExpressionYeastMutationsup35 gene is not included in this plasmid. Only…Available SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV-M-RAN-RFP6
Plasmid#106428PurposeM-RAN-RFP6 (RANbody RFP6::Sm-MYCtag)DepositorInsertM-RAN-RFP6
TagsHA, His, and Multiple MYCExpressionMammalianAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 14-3-3 epsilon K49E
Plasmid#11945DepositorAvailable SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
ROPY-2C2
Plasmid#128004PurposeLocal FRET-readout of membrane-anchored Stathmin/OP18 interaction with α-tubulinDepositorInsertROPY-2C2
ExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a(+)-T-protein
Plasmid#12652DepositorInsertT-protein
ExpressionBacterialAvailable SinceJan. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFLLFLN
Plasmid#40030DepositorInsertsFRT-Lox5171-Lox2272-FRT-loxP
Neo
ExpressionBacterial and MammalianPromoterNone and SV40Available SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
YEplac181-GAL11
Plasmid#8628DepositorAvailable SinceNov. 15, 2005AvailabilityAcademic Institutions and Nonprofits only -
UAS-<FRT.STOP<Bxb1
Plasmid#87643PurposeFor creating drosophila transgenics expressing UAS-<FRT.STOP<Bxb1DepositorInsertBxb1
ExpressionInsectAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pBSc + Shal
Plasmid#16142DepositorAvailable SinceJan. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
LexAop2-myr::4xCLIPf
Plasmid#87636PurposeFor creating drosophila transgenics expressing LexAop2-myr4x::CLIPfDepositorInsertmyr::4xCLIPf
ExpressionInsectAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET26-CNTN149L
Plasmid#100164Purposerecombinant expression of target protein as an MBP-His tag fusion at the N-terminus of target proteinDepositorInsertConcentrative nucleoside transporter
TagsMBP-HisExpressionBacterialMutationN149LPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
YCe1911 HC_Kan_Insulator_FB_p2
Plasmid#100686Purposepart designed to occupy position 22 of EMMA. Functional category: InsulatorDepositorInsertInsulator_FB
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
p259 pCMV-CRE-M (BglII)
Plasmid#12493DepositorInsertCRE-M
UseCre/LoxExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
Sus1/PET32a
Plasmid#26963DepositorInsertSus1 (SUS1 Budding Yeast)
TagsHis6 and TrxExpressionBacterialMutationwith TEV site to cleave the N-terminal his+Trx tagAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUC19_TTE1564
Plasmid#61000PurposeT7-transcription template for Tte mRNA used for in vitro translationDepositorInsertTTE1564 transcript
UseUnspecifiedPromoterT7Available SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
EKAREN5-c
Plasmid#246761PurposeControl plasmid for EKAREN5 and EKAREN5-gl (original YPet - mTurquoise-GL pair)DepositorInsertEKAREN5-c
UseLentiviralTagsnls localization motifExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EKAREN5-y
Plasmid#246762PurposeControl plasmid for EKAREN5 and EKAREN5-gl (synonymous variant YPet - mTurquoise2 pair)DepositorInsertEKAREN5-y
UseLentiviralTagsnls localization motifExpressionMammalianAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSK163 CMV-TO-SMN2 Nluc - active (exon 6, 7, 8)
Plasmid#247276PurposeExpresses human SMN2 exons 6, 7, 8 followed by NlucDepositorInsertSMN2 exons 6,7,8-Nluc (SMN2 Human)
ExpressionMammalianMutation"A" insertion at position 49 of exon 7PromoterCMV-TOAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only