We narrowed to 2,224 results for: Pam
-
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213670-rAbPurposeAnti-Integrin α4 (Mouse) chimeric recombinant antibody with fused rat variable and rabbit constant domains; binds α4 subunit.DepositorRecommended ApplicationsFlow CytometryReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral Prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Yeast GoldenBraid Cloning System and Toolkit
Plasmid Kit#1000000138PurposeThis toolkit allows generation of transcriptional units using GoldenBraid for integration in the S. cerevisiae genome at loci, YPRCΔ15 and YORWΔ22, to support high and stable transgene expression.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden Gate (GoldenBraid)Available SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPS808
Plasmid#8856DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS809
Plasmid#8935DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS810
Plasmid#8936DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -