We narrowed to 5,595 results for: GCT
-
Plasmid#72352PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorInsertATF4 (ATF4 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCB32
Plasmid#111911PurposeExpresses gRNA to target Nte1 locus and has HygR markerDepositorInsertgRNA cassette targeting Nte1 locus
UseCRISPRTagsExpressionBacterial and YeastMutationPromoterSNR52pAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorInsertZBTB5 (ZBTB5 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
alpha3-nAChR shRNA (Alpha-3.29)
Plasmid#86655Purposeexpression of shRNA targeting CHRNA3DepositorInsertCHRNA3 (alpha3-nAChR) (CHRNA3 Human)
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dUG-DH1
Plasmid#138963PurposeUsed to edit the endogenous Drosophila kkv gene to encode a fluorescent Chitin Synthase.DepositorArticleInsertDH1 oligo
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-tdTomato-sg
Plasmid#194722PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-GFP-sg
Plasmid#194717PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target GFPDepositorArticleInsertAsCpf1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorTagsExpressionMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorInsertCyr1Del-sgRNA/X1-sgRNA (CYR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP6
Plasmid#166108PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorInsertCyr1CT-sgRNA/X1-sgRNA (CYR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-BTRC-MGMT_2
Plasmid#136416PurposeLentiviral expression of gRNAs targeting intron 2 of human BTRC and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(BTRC)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTP63.1.0-gDNA
Plasmid#132432PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTP63 (TP63 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZNF696.1.0-gDNA
Plasmid#113773PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF696DepositorInsertZNF696 (ZNF696 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF700.1.0-gDNA
Plasmid#112481PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF700DepositorInsertZNF700 (ZNF700 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF227.1.0-gDNA
Plasmid#112464PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF227DepositorInsertZNF227 (ZNF227 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetropuro-IL-6 scramble
Plasmid#19960DepositorInsertpSuperRetropuro-IL-6 scramble
UseRNAi and RetroviralTagsExpressionMutationPromoterAvailable sinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only