We narrowed to 23,783 results for: c myc
-
Plasmid#169846PurposeMammalian expression plasmid for S of SARS-CoV-2 (Wuhan variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 _2-33/myc-His
Plasmid#127492PurposeExpresses myc-tagged _MTS NDUFS2 in mammalian cellsDepositorInsertNDUFS2 _2-33 (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 _2-33PromoterCMVAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 _2-78/myc-His
Plasmid#127493PurposeExpresses myc-tagged _2-78 NDUFS2 in mammalian cellsDepositorInsertNDUFS2 _2-78 (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 _2-78PromoterCMVAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA5-FRT-hMYC
Plasmid#185373PurposeFor mammalian expression of human MYCDepositorAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hMYC
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Myc-CyclinD1(WT)
Plasmid#122300Purposeexpresses Cyclin D1 protein with a Myc tagDepositorAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-AP1S3
Plasmid#58292Purposemammalian expression of AP1S3DepositorAvailable SinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Ub-Myc-LgBiT
Plasmid#241817PurposeExpresses Myc-tagged and LgBiT-tagged Ubiquitin for use with the Promega HiBiT systemDepositorInsertUbiquitin
TagsLgBiT and MycExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S212D
Plasmid#197515PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-212. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 212 changed to aspartic acidPromoterCMVAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S212A
Plasmid#197514PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-212. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 212 changed to alaninePromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKS_3MYC_PAC
Plasmid#122566PurposeVector for endogenously tagging Giardia genes with a triple Myc tag (Puromycin selection)DepositorTypeEmpty backboneTags3x c-Myc tagAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-2xMyc-Rac1-P29S
Plasmid#128581PurposeFor mammalian cell expression of P29S mutant murine RAC1 carrying 2x Myc epitope tag sequences at the N-terminus.DepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTags2xMyc epitopeExpressionMammalianMutationChanged Proline29 to Serine.Available SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-2xMyc-Rac1-Q61L
Plasmid#128582PurposeFor mammalian cell expression of Q61L mutant murine RAC1 carrying 2x Myc epitope tag sequences at the N-terminus.DepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTags2xMyc epitopeExpressionMammalianMutationChanged Glutamine61 to Leucine.Available SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 _34-78/myc-His
Plasmid#127496PurposeExpresses myc-tagged _34-78 NDUFS2 in mammalian cellsDepositorInsertNDUFS2 _34-78 (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 _34-78PromoterCMVAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 _34-66/myc-His
Plasmid#127495PurposeExpresses myc-tagged _34-66 NDUFS2 in mammalian cellsDepositorInsertNDUFS2 _34-66 (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 _34-66PromoterCMVAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMyc-N1
Plasmid#85759PurposeA mammalian expression vector with a Myc-tag at C-terminus.DepositorTypeEmpty backboneTagsMyc tagExpressionMammalianPromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-RNF146(100-182)-myc
Plasmid#196240PurposeN-terminal GST fusion of RNF146(100-182) WWE domain with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of RNF146(100-182) with a TEV protease site between GST and RNF146(100-182) encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
BirA-Myc_N_MYC
Plasmid#167715PurposeExpresses MYC in mammalian cellsDepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only