We narrowed to 41,178 results for: kan
-
Plasmid#128472PurposeEGFP entry clonesDepositorInsertEGFP entry clones
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBGV
Plasmid#62664PurposeDonor vector for mCFP knock-in via landing padDepositorInsertmCFP
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGW
Plasmid#62665PurposeDonor vector for mCitrine knock-in via landing padDepositorInsertmCitrine
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBEZ
Plasmid#62669PurposeDonor vector for tdTomato knock-in via landing padDepositorInserttdTomato
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBFB
Plasmid#62668PurposeDonor vector for tdTomato knock-in via landing padDepositorInserttdTomato
UseCre/LoxAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBBM
Plasmid#243675PurposeExpresses a maize optimized CDS of BABY BOOM in plants using the Cestrum Yellow Leaf Curling Virus (CmYLCV) 9.11 promoter and an Arabidopsis HSP terminatorDepositorInsertMaize optimized CDS of BABY BOOM
ExpressionPlantAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWUS2
Plasmid#243676PurposeExpresses a maize optimized CDS of WUSCHEL2 in plants using the Cestrum Yellow Leaf Curling Virus (CmYLCV) 9.11 promoter and an Arabidopsis HSP terminatorDepositorInsertMaize optimized CDS of WUSHCEL2
ExpressionPlantAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHYG
Plasmid#243678PurposeExpresses the HYGROMYCIN PHOSPHOTRANSFERASE (HPT) CDS in plants using the Cestrum Yellow Leaf Curling Virus (CmYLCV) 9.11 promoter and an Arabidopsis HSP terminatorDepositorInsertHYGROMYCIN PHOSPHOTRANSFERASE (HPT) CDS
ExpressionPlantAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget
Plasmid#238033PurposeEncodes sfGFP-SsrA under constitutive promoter (J23119). Expresses a single guide RNA, which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsssrAPromoterJ23119 (constitutive)Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKEK3236
Plasmid#234108PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInsertsfCherry2
ExpressionBacterialMutationE117Q/T127I/G219APromoterpJ23100-BsaIAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKEK3237
Plasmid#234091PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInsertsfGFP
TagsFLAGExpressionBacterialMutationS30R/Y39N/N105T/Y145F/I171V/A206VPromoterpJ23100-BsaIAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKEK3224
Plasmid#234086PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInsertFuGFP
ExpressionBacterialPromoterpJ23100-BsaIAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKEK3232
Plasmid#234104PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInserttsPurple
ExpressionBacterialPromoterpJ23100-BsaIAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTP489
Plasmid#216366PurposexNup155-Nb1t (+3Cys) Nanobody productionDepositorInsertxNup155-Nb1t (+3Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC263
Plasmid#216367PurposexhNup155-Nb2i Nanobody productionDepositorInsertxhNup155-Nb2i
UseAffinity Reagent/ AntibodyTags14xHis-Avi-SUMOEu1ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC100
Plasmid#216369PurposexhNup155-Nb2i Nanobody productionDepositorInsertxhNup155-Nb2i
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC99
Plasmid#216370PurposexhNup155-Nb3i Nanobody productionDepositorInsertxhNup155-Nb3i
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only