We narrowed to 350 results for: 10B
-
Plasmid#174901Purposeexpression of Mma PylRS with nuclear export sequence for amber suppression in mammalian cells; transient or piggy bac mediated integrationDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAS_MmaPylT_EF1_NES-MmaPylRS AF
Plasmid#174902Purposeexpression of Mma PylRS AF with nuclear export sequence for amber suppression in mammalian cells; transient or piggy bac mediated integrationDepositorInsertMma PylRS (pylS Methanosarcina mazei)
TagsFLAG and NESExpressionMammalianMutationY306A, Y384FPromoterEF1Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual PNG172-STII PLU-HIS
Plasmid#112992PurposeBaculovirus expression of Drosophila png172-Flag and plu-HisDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual PNG-STII PLU-HIS
Plasmid#112993PurposeBaculovirus expression of Drosophila png-Flag and plu-HisDepositorAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
dishevelled
Plasmid#38342DepositorInsertdishevelled (dsh Fly)
ExpressionBacterialAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTCW002
Plasmid#83522Purposepheromone mediated destablised-GFP expression in yeastDepositorInsertpFUS1-yEGFPCLN2PEST
ExpressionYeastPromoterpFUS1Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_SBE4:mScarlet-I-NLS
Plasmid#154961Purposeencodes transcriptional reporter of SMAD2/3DepositorInsertmScarlet
UsePiggybacTagsNLS-PESTExpressionMammalianAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-Full
Plasmid#16012DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-TCL
Plasmid#23231DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTCW007
Plasmid#83525Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 1 gene and FUSJ2 promoterDepositorInsertpFUS1J2-mfalpha1
ExpressionYeastPromoterpFUS1J2Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW008
Plasmid#83526Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 2 gene and FUSJ2 promoterDepositorInsertpFUS1J2-mfalpha2
ExpressionYeastPromoterpFUS1J2Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW010
Plasmid#83521PurposeAromatic amino acid inducible expression of alpha pheromone in yeast from the mfalpha2 geneDepositorInsertpARO9-mfalpha2
ExpressionYeastPromoterpARO9Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW009
Plasmid#83523PurposeAromatic amino acid inducible expression of alpha pheromone in yeast from the mfalpha1 geneDepositorInsertpARO9-mfalpha1
ExpressionYeastPromoterpARO9Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW005
Plasmid#83524Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 1 geneDepositorInsertpFUS1-malpha1
ExpressionYeastPromoterpFUS1Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Tet1
Plasmid#60938PurposeExpresses Tet1 in mammalian cellsDepositorAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTrc-trGPPS(CO)-LS
Plasmid#50603PurposepTrc-trGPPS(CO)-LS: A plasmid that has truncated codon optimized geranylpyrophosphate synthase and truncated limonene synthaseDepositorInsertsLimonene Synthase
ApR
LacIq
UseSynthetic BiologyExpressionBacterialMutationtruncated codon optimized geranylpyrophosphate sy…PromoterTrcAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH3U3-zif268 (omega)
Plasmid#18046DepositorInsertzif268 binding site
ExpressionBacterialMutationThe preferred binding site for zif268 is inserted…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only