We narrowed to 223 results for: PP7
-
Plasmid#64539PurposeUsed to label reporter mRNAs. Lentiviral expression of the PP7 coat protein fused to EGFP.DepositorInsertPCP
UseLentiviralTagsEGFP, FactorXa site, HA, and NLSExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-GFP-VPR
Plasmid#183936PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to VP16 activation domain; labeled with GFPDepositorInserttdPCP-GFP-VPR
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_INT
Plasmid#68436PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC593
Plasmid#62319PurposesgRNA with MS2-PP7 for yeast cellsDepositorInsertsgRNA + MS2-PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-GFP-VP16
Plasmid#183935PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to VP16 activation domain; labeled with GFPDepositorInserttdPCP-GFP-VP16 (UL48 Synthetic)
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
phage UbiC NLS HA stdPCP stdGFP
Plasmid#104099PurposeLentiviral vector expressing synonymous tandem PP7 coat protein fused to synonymous tandem GFP. Used to label reporter mRNAs.DepositorInsertstdPCP-stdGFP
UseLentiviralTagsN-terminal NLS, Two synonymous copies of GFP (C-t…ExpressionMammalianAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-CIBN
Plasmid#183937PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to optogenetic CIBN domain; bound by PHR upon blue light exposureDepositorInserttdPCP-CIBN (CIB1 Synthetic, Mustard Weed)
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AA020
Plasmid#216004PurposeFragmid fragment: (Cas protein) binds PP7 stem loopsDepositorHas ServiceCloning Grade DNAInsertPP7 Core Protein (PCP)_v1.1
UseCRISPR; FragmentAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA091
Plasmid#216106PurposeCRISPRa, gRNA expression with modified trRNA to recruit activators via PP7 tags (guide only)DepositorInsertgRNA expression with modified trRNA to recruit activators via PP7 tags
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00030 (aka pRC0707)
Plasmid#209673PurposeLentiviral vector expressing PP7-P65-HSF1DepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-A
Plasmid#200824PurposeAAV transfer plasmid encoding a circularized RNA barcode A under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-B
Plasmid#200825PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-C
Plasmid#200826PurposeAAV transfer plasmid encoding a circularized RNA barcode C under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-D
Plasmid#200827PurposeAAV transfer plasmid encoding a circularized RNA barcode D under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-24xGCN4_v4-kif18b
Plasmid#74934PurposeTranslation reporter that lacks PP7 sites in the 3'UTRDepositorInsert24xGCN4_v4-kif18b
ExpressionMammalianAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only