We narrowed to 8,864 results for: aav
-
Plasmid#180582PurposeddGFP sensor of Cdc42DepositorInsertddGFP sensor of Cdc42
UseAAVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_PM
Plasmid#177759PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_ER
Plasmid#177758PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_PM
Plasmid#177755PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_PM
Plasmid#177753PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_ER
Plasmid#177752PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn iCyt_BrEt_SnFR_ER
Plasmid#177756PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn iCyt_BrEt_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_ER
Plasmid#177754PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-LAP1-mCherry
Plasmid#159525PurposeExpresses mCherry from LAP1 promoterDepositorInsertmCherry
UseAAVExpressionMammalianPromoterLAP1Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iAChSnFR-Venus-NULL
Plasmid#137953PurposeExpresses iAChSnFR (non-binding yellow version) under hSynapsin promoterDepositorArticleInsertiAChSnFR (yellow version, non-binding variant)
UseAAVExpressionMammalianMutationcpSFGFP replaced with cpSFVenus; Y140A binding si…PromoterhSynapsinAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
2ERT2-AAVS1 TALEN-L
Plasmid#120544PurposeDrug inducible TALEN targeting the human AAVS1 locus for genome editingDepositorInsertERT2, hAAVS1 1L TALEN
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgIdua.CMV/CB-EGFP
Plasmid#121511PurposeExpresses sgRNA targeting mouse Idua intron 9 (sgIdua).DepositorInsertsgIdua
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgAspa.CMV/CB-EGFP
Plasmid#121510PurposeExpresses sgRNA targeting mouse Aspa intron 2 (sgAspa).DepositorInsertsgAspa
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S129G
Plasmid#36067DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DIO-PinkyCaMP
Plasmid#232857PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under Syn promoter in a Cre-dependent manner (DIO, double floxed inverted open reading frame)DepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hIBA1a-GFP-miR124T
Plasmid#214147PurposeAAV vector to restrict GFP expression in microglia.DepositorHas ServiceAAV5InsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry
Plasmid#50475PurposeGi-coupled hM4D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV Retrograde, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only