We narrowed to 9,800 results for: CAG
-
Plasmid#135533PurposeEncodes a specific PSD-95 binder (Xph15) fused to mNeonGreen, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
TagsmNeonGreenExpressionMammalianPromoterCAGAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eGtACR1-mRuby2-ST
Plasmid#109136PurposeAnion channelrhodopsin GtACR1 fused to ER export signal, mRuby2 and targeted to the neuronal soma and proximal dendritesDepositorInserteGtACR1-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-C1V1-TT-mRuby2-ST
Plasmid#109124PurposeCation channelrhodopsin C1V1 fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertC1V1-TT-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mGSDMD1-251
Plasmid#111565PurposeExpress ELANE-cleaved mouse GSDMD in mammalian cellsDepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AILR-LplA-ER
Plasmid#42574DepositorInsertLplA(AILR) with ER-retention sequence KDEL
TagsFLAGMutationCompared to wild-type LplA: tryptophan 37 to alan…PromoterCAGAvailable SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BDFP1.6
Plasmid#197199PurposeExpresses the protein of BDFP1.6 in mammalian cellsDepositorInsertBDFP1.6
UseAAVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-G-Rac1
Plasmid#180581PurposeddGFP sensor of Rac1DepositorInsertddGFP sensor of Rac1
UseAAVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry-LacZshRNA
Plasmid#73978PurposeLacZshRNA (mir155 backbone) was inserted into the 3'UTR of mCherry.DepositorInsertshRNA that targets the LacZ gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry-Otx2shRNA1
Plasmid#73979PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of mCherry.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGP-pcDNA3.1 Puro-CAG-Positron2
Plasmid#239079PurposeMammalian expression of positive-going voltage sensorDepositorInsertPositron2
ExpressionMammalianMutationR78K N81D D92N W178FPromoterCAGAvailable SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-mScarletP2A-hLuc
Plasmid#218793PurposeAAV reporter genome plasmidDepositorInsertNLSf-mScarletP2A-hLuc
UseAAVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-VARNAM2-Kv2.1PR
Plasmid#195533PurposeCre-dependent expression of a red fluorescent, negative response-polarity voltage indicator; soma-targetedDepositorInsertVARNAM2-Kv2.1 proximal restriction sequence
UseAAV and Cre/LoxExpressionMammalianMutationVARNAM SI linkerPromoterCAGAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-NeoR-CAG-EGFPnls-WPRE
Plasmid#191692PurposeFor knocking pCAG-EGFPnls into AAVS1 locusDepositorInsertAAVS1 homology arms and pCAG-EGFPnls
ExpressionMammalianMutationWTAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-LSL-mCherry-shPtbp1
Plasmid#178591PurposeCre-dependent expression of mCherry and a shRNA against Ptbp1 under the constitutive promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MMLV-CAG-SADB19_oG-IRES-Puro
Plasmid#172367PurposeGeneration of stable cell lines expressing the rabies optimized glycoprotein (oG), resistant to the antibiotic PuromycinDepositorInsertoG + Puro
UseRetroviralExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Nanog-pA-pgk-hph
Plasmid#74915PurposeMammalian expression of mNanogDepositorAvailable SinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR
Plasmid#157744Purposeknock CLTX-NKG2D-2B4-CD3z CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENExpressionMammalianPromoterCAGAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_CAG_Gag
Plasmid#212634PurposeLentivirus vector to express MLV GagDepositorAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only