We narrowed to 28,317 results for: cmv promoter
-
Plasmid#164615PurposeExpresses ATF4(5'UTR)-SunTag-Renilla mRNA reporter under tetracycline-inducible promoter. SunTag and Renilla luciferase are in frame with the main start codon of ATF4.DepositorInsertRenilla luciferase
Tags24xMS2v5 (3'UTR) and SunTagExpressionBacterial and MammalianPromoterTetCMVAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216481PurposeExpresses FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover to initiate immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-ePhi29 fusion - pCMV-T7-PCV2-ePhi29 (JO1420)
Plasmid#217805PurposeUnfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 MYC-Smurf2 (FF29/30A, Y459A) WT
Plasmid#24606DepositorAvailable SinceMay 5, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIE822 pCMV Bglobin intron VSVGmut K47Q R354A in pMD2
Plasmid#252774PurposeVSV-G mutant with abolished receptor binding, but maintained fusogenic capacityDepositorInsertVSVG K47Q R354A
ExpressionMammalianMutationK47Q, R354APromoterCMVAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaACAbox
Plasmid#242753PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaHbox
Plasmid#242752PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only