We narrowed to 15,359 results for: NTS;
-
Plasmid#59138PurposeORF encoding ERK KTR mClover flanked by Gateway sequencesDepositorInsertERK Kinase Translocation Reporter (MAPK1 Mouse, Human)
Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1_CD
Plasmid#83570PurposeExpresses the catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deletedPromoterCMVAvailable SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1
Plasmid#83568PurposeExpresses TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLM-mCitrine-Sox2
Plasmid#23242DepositorInsertmCitrine_2A_SOX2 (SOX2 Human, synthetic fluorescent protein)
UseLentiviralAvailable SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only