We narrowed to 28,317 results for: cmv promoter
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Click editor utilizing mSA for template recruitment - pCMV-T7-mSA-nCas9-EcKlenow (JO1391)
Plasmid#217802PurposeVariant CE1 construct with mSA for template recruitment, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; mSA-EcKlenow fusion - pCMV-T7-mSA-EcKlenow (JO1401)
Plasmid#217806PurposeUnfused click editor construct expressing mSA-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13 for template recruitment - pCMV-T7-Cdc13-nCas9-EcKlenow (JO1293)
Plasmid#217796PurposeVariant CE1 construct with Cdc13 telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V_EGFP-PEST_reporter
Plasmid#172598PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V mutant signaling.DepositorInsertmyc-PDGFRA-D842V (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842VPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV5 N-MYC hHIF1a
Plasmid#246215PurposeUsed for transfection of cells for expression N-MYC hHIF1aDepositorAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-CMV-V5-ZSWIM8
Plasmid#254997PurposeUsed to overexpress V5 tagged human ZSWIM8DepositorAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
CMV5 N-HA hHIF1a P402A
Plasmid#246216PurposeUsed for transfection of cells for expression N-HA hHIF1a P402ADepositorAvailable SinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ212:CMVp-GAD-pA
Plasmid#251312PurposeExpression of GAD under CMVp promoter for use in synthetic gene circuitsDepositorInsertGAD
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only