We narrowed to 4,637 results for: gcg
-
Plasmid#211613PurposesgRNA-A against RhnoDepositorInsertsgRNA RHNO1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gIL25_A
Plasmid#211543PurposesgRNA-A against IL25DepositorInsertsgRNA IL25
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDT2
Plasmid#199119Purposecircular transcription templateDepositorInsertlambda PR' - repeat cassette - E. coli rpoB - lambda TR'
UseTagsExpressionBacterialMutationmutated 5′-CTGGAGTGCG-3′ to 5′-CTGGAGACCG-3′ to …PromoterAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
phU6 NFATC2
Plasmid#188708PurposesgRNA plasmid encoding hU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 NFATC2
Plasmid#188711PurposesgRNA plasmid encoding hH1 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA-Target1 (MpRTN1)
Plasmid#186291PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cellsDepositorInsertsgRNA-Target1
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L5-#1
Plasmid#171513Purposedeletion of a genomic locus in Prdm14 geneDepositorInsertPrdm14 (Prdm14 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L4-#1
Plasmid#171511Purposedeletion of a genomic locus in Prdm14 geneDepositorInsertPrdm14 (Prdm14 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-sgRNA-Target1 (MpRTN1)
Plasmid#186295PurposeBinary vector for CRISPR/Cas9 (target 1: MpRTN1) in plants (for Agrobacterium-mediated genetic transformation)DepositorInsertsgRNA-Target1
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorInsertPole3 KO sgRNA (Pole3 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-mCerulean-tDeg
Plasmid#185401PurposemCerulean-tDeg fluorogenic proteinDepositorInsertmCerulean-tDeg
UseTagsExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEc-crRNA2
Plasmid#170089Purposeencodes E. coli type I-E single spacer arrayDepositorInsertE. coli type I-E single spacer array
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterJ23119Available sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#2
Plasmid#163401PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorInsertSsh3 (Ssh3 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#3
Plasmid#163402PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorInsertSsh3 (Ssh3 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
UseTagsExpressionBacterialMutationPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only