We narrowed to 12,388 results for: shRNA
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRDA_221
Plasmid#169142PurposeConstitutive expression of EGFP and sgRNAs targeted to EGFP for measurement of activity of AsCas12a\EnAsCas12a.DepositorInsertEGFP , EGFP sgRNA
UseCRISPR and LentiviralAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3G_X7
Plasmid#171213Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses eGFP for selection. Please see cloning information for suggested restriction sitesDepositorInsertN/A; empty backbone
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP
Plasmid#10676PurposeRetroviral shRNA vector. Derivative of pMKO.1 puro (Addgene plasmid #8452) with GFP instead of puromycin resistance gene.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAi and RetroviralExpressionMammalianAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHTganA-Cpf1
Plasmid#158647PurposeConstitutive transcription of FnCpf1 and ganA crRNADepositorInsertCpf1, ganA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterP43Available SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBsacA
Plasmid#158650PurposeConstitutive transcription of sacA crRNADepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2-3X-FLAG-H3.1-K27M-BFP
Plasmid#209439PurposeSB-transposable plasmid expressing a FLAGGED mutant histone H3.1-K27M with BFPDepositorInsertH3.1-K27M
ExpressionMammalianMutationK27MAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34R-FLAG-BFP
Plasmid#209440PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34R with BFPDepositorInsertH3.3-G34R
ExpressionMammalianMutationG34RAvailable SinceNov. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only