-
Plasmid#204639PurposeExpression of trancated AsCas12f sgRNA in mammalian cellsDepositorInserttrancated AsCas12f sgRNA (sgRNA-v2)
UseTagsExpressionMammalianMutationPromoterU6Available sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE-V2
Plasmid#170131PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRTagsExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57kan-T7-gRNA-U6 V2
Plasmid#115520PurposeTo construct multiple sgRNA expression vector for CRISPRDepositorInsertsgRNA scaffolf-U6 promoter
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY0663 ACTB atgRNA with v2 scaffold
Plasmid#179108PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNA with v2 scaffoldDepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA with v2 scaffold
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9PromoterAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Puro-BsmBI_entry (pRW1484)
Plasmid#225752PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Zeo-BsmBI_entry (pRW1500)
Plasmid#225753PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Zeocin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-M-dCas9
Plasmid#84506PurposeMESA target chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-copGFP-v2-no-scaffold
Plasmid#228520PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using copGFP as selection markerDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-puro-v2-no-scaffold
Plasmid#228521PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequencesDepositorInsertsUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-mTurquoise2-v2-no-scaffold
Plasmid#228522PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using mTurquoise2 as selection markerDepositorInsertmTurquoise2
UseLentiviralTagsExpressionMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-palmitoyl-mTagBFP2-BsmBI_entry (pRW1509)
Plasmid#225755PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with membrane-localized palmitoyl-mTagBFP2; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-mTagBFP2-NLS-BsmBI_entry (pRW1506)
Plasmid#225754PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with nuclear-localized mTagBFP2-NLS; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only