We narrowed to 9,671 results for: Pol
-
Plasmid#49422PurposeMammalian expression of flag-tagged human ELL2DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Syn61Δ3(ev5)
Bacterial Strain#174514PurposeRecoded E. coli strain without TCG, TCA, or TAG codons and deleted serT, serU and prfA genes. Full sequence - Genbank: CP071799.1DepositorBacterial ResistanceStreptomycinAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
ExpressionYeastPromoterAlcohol OxidaseAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPK
Plasmid#38334DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, MBP, and TEVExpressionBacterialPromoterT7Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPK
Plasmid#38333DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialPromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDKIER
Plasmid#37093DepositorExpressionMammalianPromoterCMVAvailable SinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.cLT206.V5(CM2B4)
Plasmid#28189DepositorInsertMCPyV Large T antigen (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-WT-TagRFP
Plasmid#238529PurposePlant expression of wild-type M. polymorpha CK2 alpha, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only