We narrowed to 15,445 results for: grn
-
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRGEB32-BAR
Plasmid#126072PurposeFor CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoter35S for BAR; Rice UBI for Cas9; Rice snoRNA U3 fo…Available sinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
act-AsCpf1
Plasmid#73917Purposeexpression plasmid of AsCpf1DepositorInserthAsCpf1
TagsNLS-3xHAExpressionInsectPromoteract5CAvailable sinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOsU3
Plasmid#170132PurposeFor sgRNA expression in monocotyledons protoplastsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable sinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available sinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV_hU6-sgRNA_hUbC-GFP-P2A-PuroR
Plasmid#162335PurposeLentiviral expression of S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLG1-puro Non-targeting sgRNA 1
Plasmid#109002PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertNon-targeting sgRNA #1
UseLentiviralExpressionMammalianPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK-puromycin-AflII
Plasmid#106404PurposeEmpty guide RNA cloning vector with an AflII site added from Addgene 41824DepositorTypeEmpty backboneExpressionMammalianPromoterU6Available sinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS468-pLK.O1-NmeSgRNA/DTS13-Telomere
Plasmid#85714PurposeTelomere-targeting Nme sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148500)
Plasmid#80260Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -177
Plasmid#50925PurposeU6 driven sgRNA targeting Sox17 -177 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
sh-RNA hAtg13
Plasmid#31971DepositorAvailable sinceSept. 30, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPRIME-CMV-LNGFR-FF3
Plasmid#11666Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of LNGFR and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsLNGFRExpressionMammalianAvailable sinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only