We narrowed to 8,396 results for: aav
-
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVPromoterCAGAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-RiboL1-jGCaMP8m
Plasmid#169248PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m, with a flexible GS-linker sequence attaching the ribosomal tag to the jGCaMP8m protein.DepositorInsertRiboL1-jGCaMP8m
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8m-WPRE
Plasmid#176751PurposeAAV-mediated expression of GCaMP8m under the CamKIIa promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8m
UseAAVTags6xHisExpressionMammalianPromoterCamKIIalphaAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-C-prM-E-NS1
Plasmid#175277PurposeAAV vector mediating inducible expression of 4 genes (the C-prM-E-NS1) of YFV-17DDepositorAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-SPOTlight-U2GCR
Plasmid#231889PurposeCre-dependent reporter to measure ISR state-dependent protein synthesisDepositorInsertDIO-SPOTlight-U2GCR
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hSyn1-EGFP
Plasmid#153205PurposeHuman synapsin-1 (hSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-rDA3mut
Plasmid#208706PurposeExpresses the genetically-encoded fluorescent dopamine (DA) control sensor GRAB_rDA3mut in neuronsDepositorInsertGPCR activation based dopamine (DA) control sensor GRAB_rDA3mut
UseAAVPromoterhSynAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_r5-HTmut
Plasmid#208720PurposeExpresses the red 5-HT sensor GRAB_r5-HTmut in neuronsDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HTmut
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-PSD95-mCherry
Plasmid#125694PurposeExogenous expression of PSD95 (red fluorescence)DepositorInsertPSD95-mCherry
UseAAVExpressionMammalianPromoterSynapsinAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC475 - pAAV c-fos iRFP
Plasmid#47906PurposeAn AAV vector that expresses iRFP under the c-fos promoter.DepositorInsertInfrared fluorescent protein
UseAAVExpressionMammalianPromoterc-fosAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV pmSyn1-EBFP-Cre
Plasmid#51507PurposeCan be used to generate AAV virus that will express Cre in neurons from the synapsin promoterDepositorHas ServiceAAV5InsertEBFP-Cre
UseAAVPromoterpmSyn1Available SinceJuly 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(eGFP)
Plasmid#221602PurposeA recombinant AAV2 plasmid encoding the PiGM-Iq system with CRY2PHR, CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-GFP
Plasmid#58806PurposeAAV expression of ChrimsonR-GFP under the Syn promoterDepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationK176RPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR targeting vector
Plasmid#64215PurposeTargeting vector for the human AAVS1 locus for insertion of traffic light reporter (TLR) constructDepositorInserttraffic light reporter (TLR) (AAVS1 Human)
UseHuman targetingMutationsee publication for detailsPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only