We narrowed to 42,127 results for: Eras
-
Plasmid#131379PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid changes F307A and S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S285C
Plasmid#98666PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285C and D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S329C
Plasmid#98668PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290V and S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R201K_R216K_R254K
Plasmid#104467Purposeexpress MBP hnRNPA2 LC with 4 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only