We narrowed to 7,696 results for: Pol
-
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-CD8a/d2eGFP-IRES-Nef
Plasmid#126552PurposeReplication incompetent HIV with H13L Tat and d2eGFP/CD8a reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsCD8a and GFPMutationDelta gag/polPromoterHIV LTRAvailable sinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSRP-mTAZ
Plasmid#31795DepositorInsertTAZ
UseRNAi and RetroviralPromoterRNA Pol-IIIAvailable sinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLAIΔmls
Plasmid#24594DepositorInsertHIV-1
MutationHuman immunodeficiency virus type 1, isolate BRU,…Available sinceJune 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAluYNF1
Plasmid#50933PurposeExpresses dimeric AluY RNA in mammalian cells.DepositorInsertAluYNF1
ExpressionMammalianPromoter7SL RNA promoter (pol III)Available sinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pscAluYNF1
Plasmid#50934PurposeExpresses scAluY RNA in mammalian cells.DepositorInsertscAluYNF1
ExpressionMammalianMutationthe poly(A) linker and the right arm of the dimer…Promoter7SL RNA promoter (pol III)Available sinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMLS256
Plasmid#73715PurposeSapTrap destination vector for building combined sgRNA expression + repair template vectorsDepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AY22_pgRNA.R5.1
Plasmid#100294PurposeCCR5-targeting gRNA expression plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6 RNA Pol III promoter human snRNAAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS134
Plasmid#73714PurposeSapTrap destination vector for building sgRNA expression vectors.DepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcpBpaRS_v2
Plasmid#196485PurposeTo express benzoylphenylalanine-specific variant of E. coli TyrRS (pBpaRS) and its cognate amber suppressor tRNA to allow UAG codon to be translated into benzoylphenylalanine.DepositorInsertbenzoylphenylalanine-specific variant of E. coli TyrRS (pBpaRS), amber suppressor tRNA
ExpressionMammalianPromoterSV40(synthetase), Pol III tRNA promoter (tRNA), C…Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRIAS (CC#15)
Plasmid#15147DepositorPublicationTypeEmpty backboneUseRetroviral; Avian expressionTagsgag and polAvailable sinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pfNL43-dGPE-EGFP
Plasmid#36866DepositorInsertNL43-dGPE-EGFP
UseLentiviral and RetroviralExpressionMammalianMutationparts of Gag and Pol were deleted and EGFP insert…Available sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shKGA
Plasmid#110420PurposeshKGA, silence glutaminase KGA isoform, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRISAP (CC#8)
Plasmid#15142DepositorPublicationTypeEmpty backboneUseRetroviral; Avian expressionTagsPLAP, gag, and polAvailable sinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
LHP1048 - pFB-RSP5
Plasmid#32434DepositorAvailable sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcpBpaRS
Plasmid#196484PurposeTo express benzoylphenylalanine-specific variant of E. coli TyrRS (pBpaRS) and its cognate amber suppressor tRNA to allow UAG codon to be translated into benzoylphenylalanine.DepositorInsertbenzoylphenylalanine-specific variant of E. coli TyrRS (pBpaRS), amber suppressor tRNA
ExpressionMammalianPromoterCMV (synthetase), Pol III tRNA promoter (tRNA)Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcpAzpaRS_v2
Plasmid#196483PurposeTo express azidophenylalanine-specific variant of E. coli TyrRS (pAzpaRS) and its cognate amber suppressor tRNA to allow UAG codon to be translated into azidophenylalanine.DepositorInsertazidophenylalanine-specific variant of E. coli TyrRS (pAzpaRS), amber suppressor tRNA
ExpressionMammalianPromoterSV40(synthetase), Pol III tRNA promoter (tRNA), C…Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG424-10X-tRNA
Plasmid#70125PurposeYeast high-copy TRP1 plasmid expression 10 intronless S. cerevisiae intronsDepositorInsert10X-tRNA block
ExpressionYeastPromoterNone – SUP4 pol III promoter provided by insertAvailable sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only